CL2543Contig1
Contig ID CL2543Contig1
Length 535
Number of clones 2
Definition Adiantum capillus-veneris contig: CL2543contig1 sequence.
Clone ID BP917496 BP919007
Sequence
AGTGCTCTAGCTTCCAAGCCGTGTGTTTTCTAAGTGTTAGTTCCGGTTTCAGGTTTTATT
TGCAAAGTTTCTCTGTGTCCTAAAGTCTAAAGTAAAGTTTGAGGTGAAAACCAAAGTCTA
CCGCCCTATGGGTCGGTTTCATGGCTCCGTCTTTGGGACAGAGATTACTTTTGCCTCCAG
AAGTGAGCGTCGATTGGTTTTTGGTGAAGACATAGAGTAGAGGAACGCGGGATTACACTA
TGGCCGACAAAGGGAAAGGCATTATGGAAGAGGGTTCCTCTACGTTGGACAGACAAACAA
TACCTACGGTGTTTGAGGATGGCGAGAGTTCTAGGCAACCCCTGTTTGTACCTTTTGTTG
ATGTGAATGCTCCACCAGTGCAAGGCTTTATGATTGGGCAACTTGAAGATGATGCATTCG
GGACTCAGTTGGTTGCTGCTGTGAATGTTTTCACTTGACTGGTGCAAAACCCAGGGTTTA
TGGAGTTTTTGCAAGCGCCACGAGTGCCACAACAGACAAGGAAACTCACACAACC