CL2566Contig1
Contig ID CL2566Contig1
Length 1098
Number of clones 2
Definition Adiantum capillus-veneris contig: CL2566contig1 sequence.
Clone ID DK949813 DK958878
Sequence
GGTTATAACACCATTACATCTGTCTACTTTGTTNTGCTGTTTTATGAGAAGCAAAAATCA
ATGTTGCAATGGCTTGAGTTGCCATGAGTAGGACTCCACAGCTTTACTCTGCTTAGCACA
TGTCAATCTGCATCGCATGATGCATGCACTTGACCTACTCCACTGCTCCTGTCGGACAAG
GCAAAAGTAGAATCTGCTGCAGAGCTTGTCATGTTGAAAAATGATAGCGTAGACGATGAG
AGAGATGGCGATGTCGAAAGCTCTTTGCAATTGGGGAGAGATTTAGACAGGTGAGCAGGA
CTGGAGAATGTTGATCTCGATGCCGAGTATGCCACATCAGTACATGGCATCATGGATGCT
TGTAAATTAGGGCTACAGAACGATGGTGTAGCCGAAGCTGTGGGGTTAGGACAGGAGAAA
ACGGCGGTTATAGGAGAGGAGGCGTGTGTAACAGCTTCTTGTTTTGGTTGGATCAAGCTG
GTAATGTAGGGAGAGCTCAATTGATAAAGCTGACTATGATATGATGGAAGAAGATGCTCG
GATGGTAGTCTGCATTTTTGAGGTTCAAGAGGATCACTGCCAGCCTGTGCCTTCAATCTG
CAAAGCTCAGATCTCGCCGCCATAAGCTCCTCTTGCAATTGCGCTACCCTGCATTGGAGG
ATGGAGATGGCACCCGCACAGCCGTAGACCGGGTCCTTCATGCGTGCATCGGCCTCGTAT
GCCAGAGAATTTACTGCATCCTCACGCGCGCACAGAGGCAGCTCGATGAGTAGCTTGCCC
ACGTTGCTGGCCCCAAAGAGCTTGTGGACATTGGCAAACTTTTGGGGGTCCTCTGGGGGG
AAGTAGGGTGCAAATATGCACTCTGCAGTGCATTTTCGTCTGAGAAACTTGCATGCGGCG
CACGGTGAACCGGTCGACAAAGCCATGTTGTGTGAGAGAGAGAGAGCGAGAGAGAGAGAG
AGAGAACAATCTCACCTAGATATTGGCCTTCTGTCTAGTCCATGGCTGGTGTTCTTGGAG
CTTAGATGAGCTATAGAAATACTATGACAATATAGGCAAGCAACAGGCTGATGAAGCCTT
TCTAAAGATGGGATAAAG