CL2630Contig1
Contig ID CL2630Contig1
Length 536
Number of clones 2
Definition Adiantum capillus-veneris contig: CL2630contig1 sequence.
Clone ID BP912095 BP912466
Sequence
TGAAGAGAACTGTCTATTCGTTATGTTCGAAAAAAATGCTGTACAAACTTAAAAAGCAGG
GCATGCTGGTTTATTTTGGTGGAAAGGCATCTGCAAGAGCCTTGTATCCTCGAGCTAAAA
ATAAGTGAATATACAGATTGCAATCCAACGACTAGTCCATTATGCTAAAGCCAATTGGCA
TGAGAGTGACAGAACTCTTTCTTCCATTCCAAAGAGTTACAAAGCCTAACATTGGTCTAA
GCTAAGTAGCAAAGTATTCGATGGAAAAGACGCCCCCTCGAAAAAGTATCCCTTATCATA
TGGCAGCCCTCACTGCTTCTCTTCTGATACGAGCAGCCTTACCAGAACCTCGGAAGTACA
TATATACTTGCTTTAGAACCCACAAGCTGAGCAGGGCTTCCAAAACAAAGCAAACTGTAC
CGACAATGTAGAATATCCCGACCAATGTCGAATCCGAAAACAAATCAATCGCAGGGAGAA
TACCCGCAAGAGATTTTCCTTTGAACACAACCGGAGGTGCTACCGCAGCAAAGATG