CL2677Contig1
Contig ID CL2677Contig1
Length 496
Number of clones 2
Definition Adiantum capillus-veneris contig: CL2677contig1 sequence.
Clone ID BP917098 BP918502
Sequence
ATGAAGGCAAAAAGGGAGCAAATAAAGAGGAGGAAGGCATGAATCAAAGGTGCGTCTTCG
GGTGTCACTGAGGATGCAGATGAAGACGGGGAAGCTGCTCTATTCACAATAGAAGTCCCG
ACTTGGGGCTTCCAACGGTGGATGCATTAACGTTGTAACATGTGGAGGGTGCCCAGCCAA
AAGTCATTGCTTGTAGATTGAAAAAGAACTCATAGCCTCCCATGAAGTTATGTCCAATTA
TCCCCGTGCTTGAGCTAATTGGTGTGATGCCCAGACAAAAAAATACCACGTTGCCCCTTG
TATTAATAAAGGTGACGTAGGGGTCGGATATGTCCCATGTGCTTCCTCCGGCCAACGTGA
TTGTCAAAGTTGGAAGAGAATTCAAAGCATTGTTGTCACTTGTATTCCAACAGTAGTCAA
ATGTGCCGTTAAGTTGAAATTGGGGCAAGTTGATTTGCTTATTCATCATGTCACCAATTT
TATGATAAGTTGATTG