CL2726Contig1
Contig ID CL2726Contig1
Length 714
Number of clones 2
Definition Adiantum capillus-veneris contig: CL2726contig1 sequence.
Clone ID BP911713 BP915517
Sequence
GCCGCAATATCATTTACTTCTGCCTTCAATCTTACTATTGCTTCTGACTCTTGTCCTTTG
ATCTTCTCTAAAGATTCCAAGCATCCTTTCTCTATTGGAATGCTGTTCAAAGCATTCCTG
ATTTTTTCAATTTCCAATCTCTTTGAATTCAGCTCTTTGTCTAATGCAGTTGCTTCCTCT
TTCTTCGACGCAAGCTGTTTCTTCTTTTCTTTCAATTCCTTTTCCAAATGCTGAATCTTA
GTTTTCGCCTGCTTGGATTCCGTGCTCGCTTTTCCAACTGCAGCTTTGGTCTCTGCAAGC
TGATCTGCTAAACTTTGTTCTTCATTGCCTCCACTCGTACCTGCTTGCACACCCTGGTAA
TCTTTTTCAAGCTCAGCTAAGGTGGATGTTAGCATATCCACTTTTGCCTTTAAGCCTGAT
GCATCTTCATTTAGCTCTACAATCGCTGCACATTTTTCCTCGTAGGAAGCCTCAATATCC
TTGATACTTTTCTCAAGCTTAGTAATAGAAGACTTTTCTGTTTTCAATGTATCCTTTTGA
TTTGTGTATATAGATGTCTCTTTGACCATCGCGTTTGATAACTTGTCGACTTTATCAGAC
AAATCCTTCATGTCATTTCCCATTCTCTGCTCTTTCTCCATGGTAAGCTCTGAGATGGCT
TTTTCCTTCTCTGTTATTTCACTCGTTAGCTCCTTTACAGAATCTTGTGATTCA