CL2787Contig1
Contig ID CL2787Contig1
Length 858
Number of clones 2
Definition Adiantum capillus-veneris contig: CL2787contig1 sequence.
Clone ID DK950522 DK959498
Sequence
CGAACAATACAATCTGCTATCGGACATCTTCATATGCTGCCACTGTCCAGGCCCAATTCC
ACAAGTAACTCAGATAAGGCAGCAATTTTTGCGGTGAAAATGAGTTAGCTAATTCTGGCA
AGGCCTGCCTGTTGTGGAGCATTTGCTTCCATTCATGTCTCTTTTTTTCTAGCTAGCAGA
AACCTGTCCCACTTCAATGCTTACTCTACCTTGGTAACTTCTCCTTTCTTTTTGTTACTG
ACAACTGTTTCCTTGACGGGGGGTGATACAAAATCTTTTGAAGACTGAAGTATGTGTAAA
GCAGTAACAAGTGTCAACACAAATCCTGAACCAAAGAGAACGTAGAGACCTGTTTCAACA
TCAACAACTGCTTGCTTCTCCCATTGATACTGGACCAATATCTGCTTCGGCCACTTATGA
ACATCCCACTAATGTTTCATCACAGACTCGTGCTGCACAACATATTTGTGTGGCATGCTT
TCAACCTTCGCAACAGCACCTTGCAAGTCACCCCCAGCATATCTCAGTTTGATGGTGATC
ATGTGGGACTTCGGCACTAGGACGTCCAACTACAAATAACCAGGGGGTATGAAACTTCTC
TTTTCCAATCAGGAGAGCTATTTTGTAGGCATCTGCTCGTGTATAACCTGTGGGCTTGGA
AATAGGCAAGAGCACCTCTCTTTCAATGCCAAACCGAGGGCAATGATGACCAAGAATATC
CTCCCGAAGTGCTCCTCATAGAGTGATAGTGAGTTTGAAGCGCCATAGGAACAAAATCTC
CAGGTCTGTAGCCTAGGCACGTGGGAGCGAGGAAGCAAAAGTAGACGAGAACAAGCACAC
GCGAGCGGAAGATGGAAG