CL2845Contig1
Contig ID CL2845Contig1
Length 718
Number of clones 2
Definition Adiantum capillus-veneris contig: CL2845contig1 sequence.
Clone ID BP915924 DK958331
Sequence
GATAAGGAAGAGGAGGATGGATGTGATTTTTGCCAGCCTTTTGGAGGCTTCTCCTCAACC
GCCCTTGCTAGTGCTCTTTCTCAAGCTCTCTCTGGTGATCTGCCCCTCTTGTCTACGACA
TGGCCGCCTGAATGGATGGACAAGCTTGCTCATTATTCCCAACTTCTGCCTGTTCCATGA
CCTTCCAAGTGCTCACACATTGTGGATGAGCAAGAAACCCATATACATGATTTAGTGTTC
CTTGTGTATTGCTTTTACTCCCTCTCTCATCTGTCTGCCGCATGTGAGGTTACCATTCCT
TCCATCTGTTCTCACTGAGAAGTATTGCATGTGCATAACACATACAGGAAGCACAATATA
GTGCCATGGTGCATCATCATGCTAGATGAGGATATTCTCACTACATCAACAAATGCACAT
GTGTGACTATGGATTGCTTGCCACATGCAGCACAAAGGCTCTTACATACATACATCTCTA
GACATGTCCCTTGTATGTGTGAATGCATGTATGATTCCTCGGGGCTTGCATGTACGCACG
ACATTTCATGTCATGCGATTCTGCATTCGAGTTTGCATGCATCACCTATGTTCTCAACCC
AGCACTGTCCATTCTTTTTGATCCAAGATGAGTTGACCCATGTACATTAACACCCTTCTT
GACTTGTACATTTATGCCATTCTTCAGCTTTCTAAAAGCATGCCCTTTTGGATTTGCT