CL2856Contig1
Contig ID CL2856Contig1
Length 403
Number of clones 2
Definition Adiantum capillus-veneris contig: CL2856contig1 sequence.
Clone ID BP912144 BP919412
Sequence
GAATATTACCTGCAGGTACTCGGAACTTTGTGAATTCCCTTTGATAGAGTTCTCCTATGA
AGTTTGCCGAGGAAGTACATGGGCAACGATGGCCAAGGAAGTACAAGGGCAAGAATAGCC
AAGGCTGAAAAGGCAAGCTATATAAAGAAAGAATTTGCAGGACTTTCTTAAGTTGTGGTC
CTTGCATGCATGCAGAGTAAACGTGATAGAGAAACTTCGTCTGACTCTTCACCTAGACCA
CAACAAGCGTACGACGTGCAGAGGTCAATCGGGCTATAAATCCAGAGAGAAGCTATCATG
GCATGTCAATGCTCATCAAATTAAGAGGGCAAAACATTTGAGGCCATGCATGCTGTGCTA
ATAAATGAAACCCTGCCAATAATATTCATGGGAGGAAGAGAAG