CL2881Contig1
Contig ID CL2881Contig1
Length 816
Number of clones 2
Definition Adiantum capillus-veneris contig: CL2881contig1 sequence.
Clone ID BP913655 DK963592
Sequence
CACCTCAATACTATGTATGCACATTNAAGTGCTATGACAAAGGGAGGAATATCACTCCTG
CAACCTACAGTAGAACGATACACATACACACTCTCAACTAGATCCTCACTTTCCTCTTTC
CCCTCTTTCCTGATGACCTCGACAACCAATCGCCCACGCTTTGCAGCTGCTAGGGACATG
CAGCCCTGCATGGTAACATGGCAACCTGACATCCAAAGAGACCTCATAGATTCATAGCGA
TCGATTCCAGCAAGGAGAGCCTCATCTCCATAAGGGCTATCCCTGATCTCAAGCTTCAAT
AGGTTTGTACAACCCCGTAAAACACATTGCATTCCAATGTTGCTTCCTCCGGCAAAAGCA
ATGGACAGCCTTTGCAGCTCTTTCCCAAAATATCCAATGTACTCAAATACTTTGTCGGTC
AGCATTCCTGACAAAGACAATCGACGAAGGCATTTACAGTTTCTTACAATAGCTCCGAAG
CCCTCATCCATCGGCTGATTGGTTGTTGGGTCTAGCATTAAAGGATTGATGAGGGCTAGC
CGAAAGGTTTCCAACAATGGGCACCTTCTTGCCATAGTAACAACAGCATCATTTGTGATC
CTTCTACAGAAATACAGGATCGATGTGAGATTCGGGCAACCCTCTGAAATTGCCAGTAAA
CCCTCTTCAGACACACCCTGTCCATCTCCCTCACTTGGATAAACACGAATATGTTTCAAA
CCCTTACATGTTGAGGCAGCTGCTCTCAGTCCCCTATCCTCAACGGAGTCCAAGATCCAT
AAACGTTCAAGATTCTGGCATTGAGTTATAAGTTCC