CL2907Contig1
Contig ID CL2907Contig1
Length 754
Number of clones 2
Definition Adiantum capillus-veneris contig: CL2907contig1 sequence.
Clone ID BP913466 DK948869
Sequence
AGAGATATCTGCGAAAGTGCTATTCCCAATCCACCTCTTTTGTCCATTCAAAAGCCACCC
TCCTTCCACCTTTGTTGCTGTTGTACTCAAAGAGCTTGCATCACTACCAAAATCGGGTTC
TGTAAGAGCCCAACAAGCTATAGTATCAAGACGTGCCAAAGAAGGTAAATATTTTTGCTT
CTGTTCTTCACTCCCACACATTGCAATTGTAAGCATAGCTAAGCACGTATGCACCATCAT
AAAAGTTGAACAGCTTGCATCAACCCGTGCAATTTCTGCCATAGCTAAGGCACTTCCAAC
GACAGACAGTCCTGGGCAGCCATAGCCCTTGATGGTTCCTCCTGCAACCTTCAACTTTGC
CAAGTTGGGTACAATCTCAAAAGGAAACTCTGCACGTTCCCAATACTTGGCTATGATGGG
TGCAATATCTCGCTCAGCAGTTTCTCTCACCCGTATACGTATAGCTCTCTCCTCCGGTGT
CAAGAGATCGTCAAGTTGATAATAGTCAGAGACTGAGTGTGGAAACTTGGAAGCAGGTGT
TGCTTGAGGAAACGCTTGAGATATATCCAAGCCAGCTGACAAATGTTGCTCTTCTTTTGC
ATGTTCGGCAATCAACTCGCCAGCAGCGGAGGTGGTGCTCATGTGCAAAGACATCACGTC
CTACGCCCCAAAGGGCCGGGAAAAGAAGCGAGACGACTGATGAATAGTCGCCCTGTGTTG
TATTGCAGTTCGACTCGAAGAAGAAATCTCAGCA