CL2927Contig1
Contig ID CL2927Contig1
Length 520
Number of clones 2
Definition Adiantum capillus-veneris contig: CL2927contig1 sequence.
Clone ID BP913059 BP917774
Sequence
CCATCCTTGACAATATAATCTACATCACGCTGATAAAATTCTTTGGCACAAAGAGCAGAC
ACAACAAATCTGGCCCAAGGATCTTTCTCACTCCAAAGATCATCCGTATCCAAAGCAAGC
TCTGCAGCAGTTATGCCTTCCTCAGTGAGCTCCACACTCTTCTCCATAGGCTGTGTTGTA
TAATGCTGTTTTCGTACTAGCAACTCGGCTACTTTAGCAGCAACAGGAAACCTGACAACA
TCCTTGCTAGATGTGGTGCTAATAATCAAGGGGTTTCGTCCCTCATCAATGAGCACAGAA
TCCACCTCATCAACAATGGCATAATTGAAGGGCCTTGGCCATCGTAGTACTTGAGCTTCC
TTTTACTGACTTATATTATCTCGCAAGTAATCAAATCCAATTTCCGTATTATTTGTGAAA
GTAATGTCACAGCTGTAAGCAGCTTTCTTCTCTGCATTGTTCATCCCACTCTGAATAAGG
CCTACCGAAAGCCCCAAAAAACGATGAATTCTCCCCATCC