CL2956Contig1
Contig ID CL2956Contig1
Length 684
Number of clones 2
Definition Adiantum capillus-veneris contig: CL2956contig1 sequence.
Clone ID DK954394 DK948970
Sequence
CTCCATCGTTGAGCTCGCCAGCAGCTGCAAGCACAGACTCAAAGAGCTCGCAGTGCGGTA
ACGAAGATGGTCGAGCAGCTTTCTGGAGACCAGATCTCAGAGTTTAAAGAAGCTTTCAGC
CTCTTCGACAAGGATGGGGACGGCTGCATTACTACGAAGGAGCTAGGAACAGTCATGAGA
TCATTGGGTCAAAACCCCACTGAAGCTGAGCTACAAGACATGATAAATGAGGTTGATGCA
GATGGAAATGGAACCATTGATTTTGCTGAGTTTCTCAACCTTATGGCGCGCAAAATGAAG
GATACAGATTCTGAGGAAGAGCTCAAAGAAGCTTTTCGTGTTTTTGACAAAGATCAGAAT
GGCTTTATTTCTGCAGCAGAGCTTCGCCATGTGATGACTAACCTTGGAGAAAAGCTTAGT
GATGAGGAAGTTGATGAGATGATAAGAGAGGCAGACGTTGATGGAGACGGCCAGATTAAT
TATGAAGAATTTGTTAAGATGATGTTGGGCAAGTAGTGGCTTTACTTTTTGTTCCTTGAG
ATTCATTTGATTCTATAAAATTAGTCATGGTGATGATCCTCTCAACATTGTTTTGGTCAC
TCAGTCATTGTAGGCATGTTTGGATGTATGAAGGGAGGTGTTCTTGGTGTAGTTTTGTAG
CTATTGTCTATTTGAATGTGCTTC