CL3741Contig1
Contig ID CL3741Contig1
Length 509
Number of clones 2
Definition Adiantum capillus-veneris contig: CL3741contig1 sequence.
Clone ID BP914550 BP916065
Sequence
AATCTAAAAAACCTTCTACTTCCCACAAGCAACCTGACTTTACGTGAAGATCCACAATGC
AGGTGTAGTGGTCAATTGTCGGACTGATGCCATACTTCTCTCTCATGAAATTGAATATTT
CTTGGCCCTTTCGTAGCAACTTCGCCCTACTACAAGCAGAGAGAACACAAGTAAAGGTAA
CCACGTCTGGTTCAACATCCTGGTTTTGCATTTCCTCAAAGCACTGAACAGCCATTTCAC
CATCATGATTTGATCCATAGGCCTTTATCAGTGCATTCCATGAGACTACGTCTTTTCTTG
GCATTCTGGAGAACAAGTCTTGCGAGTCCAACAAAAACCCTGCTGCTCCATACATATCAA
TTAAAGTGTTGCACACAGAGATGTCATTTTCAAACCCCCTTAACACTATGTCTCCATGTA
TCTCTTGGCCTTTATCGTACGCTCCAATATTACTACAGGATTTCAAGACACAAACTGCAG
TAACAGAATTTGGAGAAACAGCCTCTACT