CL582Contig1
Contig ID CL582Contig1
Length 1228
Number of clones 5
Definition Adiantum capillus-veneris contig: CL582contig1 sequence.
Clone ID BP911711 DK951784 DK952755 DK954186 DK949054
Sequence
CCCTCGAGTTAATGATGATGATGATGGTGGGATCGTGTCGGCCATAGTCTCTTTGTGTAG
CAACAATGGCCTTAACCACATATAGAATATCTTCTTTTGCGACATAACCCATAGGCTCTG
CCAACCTGGGAAATGTATGCTCCATCCTATGAGTCCTTCCCATCCCTCCACCAACATAGA
TGTTGAAACCTTTGGGTTCCCCGTCATCGTCACTGATCACAACTAGCCCAACATCATTAG
TCAAGAGGTCAACTGAGTTATCTCGCGGTACTGCTACTGCCACCTTGAACTTCCGTGGAA
GAAATTGTGTACCATAAAGTGGTTCAGGTGAGTCTTCAAAGTTAATGTCACGGGAATTAT
CATTCAAAACCTCTATGACATCAGGAGGGTCTGCCGACATTATCTTCTCCCCGTCCACCC
ACATGTCATAATAGGAGCCTGCTTTAGGAGCCAAAAGTGCAGCTATTTTATCAGCAGTTT
CTTGGGCAAACAAATAATCTTTCCTTGTAAAAGGAAAAGCAGGTGCCATGACATTACGGT
TCAAATCACCACAAGCACCCAACGTTGAGCCCATACTCTTTATGATTGTGCTCATGACAG
TCTTTAAGTTATGCTTCAAAACACCATGAAGCTGGAATGTTTGTCGCGTCGTCAGACGTA
GAGTTCTGATCCCAAACTGGTCGGCGAGTTCATCCATCACCAAATACAGTTTATTTGATA
CCTTTCCAGACGGTTGTTTCGTCCTTAGCATAAATTGGTAAGCCTTTCCTCCAACCCTGT
CCTCTCTGTTGTCTTGTTGATAGCTCCCATGAAACTTGATTAATTGGACTGCTGCTTCAT
TGATATTAGGAGCCTCAGTTTCTAGTTCTTCCTTTAGAGGAAATCGAAGGTAATTGCTCT
GCTCCTTGATAATCTCTACTTTGCTCCGTTTCACTGGGAGAGAATTCGGCGGCTTCACTG
GCGCGGCTACTGCCTTCACACGTGAAAAGCTGCTTAATTGGTTTTGTCTTTTGTATTCCA
GTGAGGGTGTAGCTTGTGAACTCTTGATTCCTTTCAAGCCTTCAAACGCAGTGAAATTCA
CAGCTCCAGAGATCTCCATCTTCTCTCCTGATTAAATCCAATGCAGCAGAAGAAGACTCA
GCGAAGAGAAGCCAAAGTACTCTGACGGCGATGGCAACTAACAGTAAGCAGTGGAAGCTA
TGGGGCAAAAACCTTGGCCAAATACAAT