S03036-01_A01
Seqid S03036-01_A01
Sequence >S03036-01_A01.phd
NNNNNNNNNNNNNNNNNNNNNNNGNNNANANNNGNGATTGGCGGCCNNTCGGCCGAATTG
ATCATCAAACAAGCAACTACAAAAAAGCTTTACTGACAACTCACACAAATAACACAAAAA
ACAAAAACTTCAACAATGGTCGCCTTTTTAGAACTAACTTCTGACGTTTCTCAACCTTTT
GTCATCCCATCTCTTTCGCCAGTCTCTCAGCCAAGCTCAAGAAAGAACTCTGACGCAAAC
GTCGATGACCTGAATCTGGCTATTGCCAATGCCGCTCTTTTGGATGCCTCTGCTTCAAGC
CGCTCACACTCCAGAAAAAACTCTTTGTCTCTGTTGTAAGTGTTGTACACGAGAATTAAC
ACACTATTAGCATAAAAGACATTTGGCATCTTTACTTACTTGGGCAAGTAAGTCACGTAC
TTTTTTTTTTTTTCCGGAGCATTCATTGTCATTCTATCTGCACTTTCCCGCACTTACATT
CAATAACCTCGGATCGGGTCTCTTCTACGACAGAAACTTTTTGATATATACATATTTATG
CAATATAAATACTGAGAAAGTGTNAGAAAGAAAAAAAAAATAAANAGAAAAATAAAACAA
ATNAACACCGCGAGGGGNGGGGGGGAGGANGATAAGANAAGTATTTAATTTAAAAAACCN
AAGANTTAGGGAAAACNTACNGTNTTTATGAGGCNTCGGGGGGCAAATAGATGAGCCATA
ACACACCCCCAGTCTGAGGGNAGAGNAGAGTGTTGGAAATATTTTTTTATACANACNCGA
CAATAANANTANNGGCGAGGTATAGANTTTTNNNNNGGGGGAAATAAAANNNACAATAAT
ACATACACCCCCCCCCCGCATGCNNGCGCGCGGAAGAGGAAGAAAGTGNNAN
Quality >S03036-01_A01.phd
5 2 3 2 2 2 3 3 3 2 3 5 2 3 3 3 3
5 5 7 5 6 7 8 3 5 5 12 6 16 6 6 6 9
7 16 21 10 15 21 14 10 31 27 8 10 7 7 14 25 35
28 28 25 18 21 9 19 29 24 9 21 27 26 31 31 26 26
36 31 23 24 27 29 35 32 29 31 30 35 32 37 40 29 29
40 36 30 30 30 35 41 35 43 52 42 35 17 25 43 40 29
41 46 41 50 40 36 36 43 35 32 36 44 44 33 42 46 40
39 49 54 50 50 49 46 49 50 49 49 44 44 43 50 50 54
54 63 51 60 51 50 50 54 60 60 47 60 44 50 60 63 50
50 50 50 63 63 47 58 57 57 57 58 52 60 60 60 52 52
52 54 52 60 57 58 63 63 63 63 63 58 58 57 63 63 60
58 63 63 63 63 63 63 63 63 63 63 58 63 52 63 63 63
63 63 53 57 53 57 60 52 52 60 57 57 52 57 57 57 57
63 63 60 57 58 53 53 57 57 57 57 48 48 57 60 60 45
53 53 60 43 43 32 37 44 53 58 52 57 63 63 63 63 57
63 63 63 63 58 63 60 57 63 63 58 58 52 58 60 63 57
63 58 58 58 63 63 63 60 60 63 57 53 52 58 57 63 57
57 57 63 58 58 58 58 57 58 60 63 63 63 63 63 57 57
59 60 63 58 60 57 57 52 58 63 63 63 63 63 52 60 60
60 57 57 57 60 60 63 58 57 63 60 60 57 57 57 58 57
58 63 57 57 58 57 57 60 53 53 57 57 57 53 57 52 57
57 60 53 57 57 57 57 57 60 57 53 53 60 57 60 60 57
60 58 60 60 53 57 60 63 63 60 57 52 60 60 57 60 60
60 57 57 58 60 63 60 57 60 63 63 60 58 57 57 53 53
53 60 53 53 60 57 57 52 53 53 60 57 60 53 53 53 53
60 60 57 57 53 60 53 57 60 52 57 60 53 35 53 60 52
60 52 38 53 53 60 41 45 42 53 53 53 31 42 47 53 53
53 53 44 53 53 42 27 28 35 35 31 41 33 37 53 53 53
53 42 52 60 53 42 45 45 53 53 53 53 53 44 37 37 46
35 38 27 46 35 38 38 47 41 60 53 42 53 40 29 12 42
32 42 34 52 53 46 53 53 57 57 60 53 44 37 20 42 42
47 42 53 53 42 42 31 31 35 27 25 38 53 53 42 42 24
53 41 35 30 23 34 33 42 25 30 34 32 41 23 24 14 16
9 8 7 14 11 16 9 9 9 9 10 10 10 22 22 22 16
28 19 11 9 9 16 6 8 13 18 19 24 13 25 11 20 17
11 11 10 11 11 10 9 6 9 13 13 10 10 12 13 11 10
9 15 17 13 9 6 10 10 14 9 17 19 10 9 9 9 10
7 9 9 8 8 11 11 15 7 14 11 11 12 9 9 10 8
15 29 19 11 11 10 10 12 19 15 14 8 8 6 16 29 12
16 7 10 11 11 9 14 11 11 10 23 15 9 7 10 11 14
6 12 9 7 9 10 23 13 16 12 10 14 16 9 6 9 11
10 10 11 13 15 10 9 15 10 16 14 14 14 10 16 21 11
11 12 12 9 10 12 10 9 11 10 16 16 17 10 10 10 10
11 11 11 8 16 17 16 14 20 7 8 9 9 12 7 8 8
12 9 8 13 11 12 8 10 10 10 16 10 13 12 22 16 14
22 17 13 18 16 8 11 13 7 10 11 7 11 16 13 11 41
23 13 8 10 7 12 7 9 12 7 7 10 12 11 17 11 9
13 9 9 11 10 14 12 7 15 8 14 10 6 6 6 5 5
12 14 17 17 9 14 16 11 13 28 30 23 8 6 4 5 10
14 14 21 10 10 19 14 15 12 11 15 19 13 15 17 20 23
22 19 17 12 17 14 17 11 15 19 16 8 14 7 7 10 11
10 13 8 14 15 28 19 9 11 14 11 29 14 9 9 9 9
11 11 10 14 6 6 15 7