S03036-01_A02
Seqid S03036-01_A02
Sequence >S03036-01_A02.phd
NNNNNNNNNNNNTTNGTNTNNNNNCGNNNNNNNGGGNGATTGGCGGCCAAATCGGCCGAA
TTCCCATGGGGATCCGATATCAAGCTTGGGCCCGGTATAACTTACATAACCTTTAAATGA
TTTTTTCTAATTATTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAG
TACCGGCCATAAGGGCCAGCTTGAGTATTCTATAGTGTCACCTAAATAGCTTGGCGTAAT
CATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATAC
GAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAA
TTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAAT
GAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGC
TCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGG
CGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGNNNNNN
NNANCAAAAGGNCAGGAACCGTAAAAAGGGCGCGTTGCTGGCNTTNNNCATANGGTNNGC
CNCCTGACAAGCATCAAAAANNNGACNCTNNNNNNNNATGNGGGNAAANNGNCAAGANAA
NAAAANNNNCNCNNNNNNNNTGNNGNNNNTGGGNGNANACNAGTNCNNNNNNNNNNNANG
NNACTGNCACGNNNCTCCNNNGGNAGNNNGNNGNTANNAAAANNANNNANNNNNACANNN
ANGCNNNGAANTAACANAAANNNGNNNN
Quality >S03036-01_A02.phd
4 3 3 2 2 3 5 2 2 3 3 3 15 11 6 9 8
7 8 6 6 7 7 5 9 9 5 5 3 3 3 3 3 8
13 13 7 23 23 12 34 29 14 11 38 25 13 17 10 15 30
37 37 41 24 36 38 31 25 16 21 35 24 22 24 18 47 43
45 49 35 13 13 33 28 32 52 35 52 37 33 43 39 37 49
49 49 42 21 12 26 20 16 17 35 30 32 54 41 42 42 50
34 42 50 33 50 49 46 49 54 54 54 34 42 43 42 54 50
38 33 40 39 41 40 46 46 34 42 43 54 42 42 50 42 17
8 8 39 46 37 42 37 42 39 35 12 33 29 23 37 42 42
42 46 46 49 49 49 46 46 49 46 53 57 53 49 49 49 46
46 49 50 49 42 31 39 26 9 30 42 42 43 54 54 54 59
33 32 35 33 43 43 50 43 46 40 36 35 36 46 35 35 30
25 27 35 43 46 35 29 32 28 30 26 23 35 35 41 30 50
49 42 54 49 54 36 35 35 41 35 35 40 42 31 37 29 43
54 43 54 29 32 46 43 28 35 29 31 32 35 37 46 54 49
49 49 54 54 46 46 36 36 32 32 43 49 49 42 49 49 32
30 35 46 54 54 29 30 30 35 29 38 40 59 54 54 49 32
21 35 35 31 35 52 41 35 35 35 35 33 50 43 49 49 35
37 46 49 35 37 35 35 52 46 37 37 35 42 35 46 49 49
35 37 46 36 49 53 51 49 35 49 37 42 42 46 46 35 49
32 31 31 37 35 41 42 42 46 46 40 35 50 24 46 41 49
49 43 49 33 34 35 26 25 33 35 43 41 46 41 38 46 21
25 23 35 51 52 52 49 49 49 53 49 35 49 31 46 49 46
41 49 49 50 49 46 28 40 37 46 37 43 46 35 51 36 49
28 35 49 46 50 52 35 37 46 37 49 32 46 46 49 34 50
46 42 42 41 41 49 32 34 50 30 46 49 49 40 31 21 16
34 26 50 21 49 49 34 49 46 42 30 42 36 28 35 29 39
36 49 29 35 28 32 30 46 34 34 36 26 30 29 33 32 46
26 41 34 30 31 30 26 35 41 42 42 41 50 32 34 28 37
36 25 32 30 50 32 46 49 19 34 40 28 49 36 41 42 30
49 32 29 28 41 34 31 35 16 20 28 29 32 21 28 26 28
11 18 26 20 21 27 30 26 18 47 43 12 40 16 32 37 28
18 14 22 28 28 22 29 12 35 26 30 30 33 9 40 20 34
29 15 17 26 12 31 17 10 16 19 9 25 25 19 20 32 26
26 26 12 21 12 9 9 16 13 16 22 17 17 9 22 10 5
5 5 7 5 5 3 5 8 5 21 9 21 21 18 12 10 3
10 8 8 29 26 33 19 13 9 10 12 14 19 32 26 23 10
8 25 13 14 25 13 12 12 12 14 26 11 9 6 33 13 5
5 5 8 12 14 20 6 18 9 9 6 5 9 15 8 6 9
17 25 18 13 9 12 19 16 19 20 28 14 12 12 39 35 10
3 3 5 17 11 12 6 9 9 6 5 5 5 5 5 5 7
23 8 20 7 18 19 9 6 18 18 10 7 7 9 5 9 12
9 8 8 5 9 16 7 12 28 8 8 7 5 5 7 9 7
9 6 6 6 6 5 5 6 5 9 30 6 5 15 6 6 6
6 15 10 10 12 7 18 7 9 6 11 9 6 11 10 17 6
8 6 6 6 6 6 6 6 6 5 7 7 9 5 11 6 5
10 19 17 12 6 9 10 12 9 6 6 7 12 16 19 10 6
6 6 8 20 5 30 10 6 7 5 13 6 6 9 6 13 9
6 7 15 16 15 8 6 5 9 6 6 6 9 6 5 6 5
5 11 10 15 6 6 6 9 6 10 12 6 6 6 18 9 9
6 13 10 11 8 9 5 17 9 10 7 6 6 9 6 6 6
6