S03036-01_A11
Seqid S03036-01_A11
Sequence >S03036-01_A11.phd
NNNTNNNTNTNNNNTTNGGCNCNNNNNANNANNNNNANNGNNGNNTCGGNNTAATANTTA
AAAACTTATAAANAAANNAAAGTCTCAANNNTTCNGTNAGTTCTCGACTGNTGGGGGTGT
CGCTTTATTCGCCTTGGCTAAGATGGTCATTGCCAATTCCGAAGAATTCGGCCTNGTGAG
TATCCGTTCCGGCTCNGATTTACAATACTTGAGTGTTTNGGGNGGGAACGGGGGTTTGAA
ACTTGGCTGCGGTAGTGGCTCATTTGAGGCAACTATTACCGATGACNGTNAACTGTTTTT
GACGANGATNAATATGCCGATGTCGATCAGGAGAGCGCACGCAAGAANAGNTGTGAGAAA
TATNCTCTACTTTTTTATTNAGAAAACNGAANGGTCCATGAAGGAAAGGTTAAGTCGAAA
AATAAGGAAAAAACCTTTTCAACNNCNANGGAAAANATGNAAANAATTTATAAGNTCTAT
ATCAAAACTAAAAAAAAAAAGAAATCAGTTCANTCGCGACAACCTCAAAAAAATGTATAA
AAAGAGTCATAAAAAGCCANNNAAACCAAAAGGAGCGGGGTTAGGNATATNNNTATAAAA
TGNAGTTTCCACACTACTTTTAAGTGCAAAGTAAAAGAGNATATATTTTTATAAGTCATA
TAAAGAANAGAGANGGGGATATAAAATTTTAATAAATTANANAAACAAAAACAACCACAA
CCTTTCTGNTTTGCAGNAAGAAGGGGGNANNAGNTATTAGTAANCNACCNAACAACCNCC
GGGGCCGAGCNAGNAGGGGGGGAGGAGAAAAGAAAAATTATTTTTTTTATTTAGAAGA
Quality >S03036-01_A11.phd
4 2 5 8 5 5 3 8 5 11 5 5 3 5 9 9 6
17 15 9 5 9 7 5 7 6 3 8 5 7 10 7 5 7
6 6 9 7 6 9 7 6 9 7 7 11 9 15 9 6 7
11 11 8 10 9 6 8 9 8 11 9 9 11 18 26 11 12
12 22 16 9 6 9 9 9 6 6 23 11 9 9 10 23 9
14 9 8 6 5 5 8 9 8 6 10 11 7 11 11 8 11
11 11 10 14 10 9 9 16 6 9 9 12 23 11 9 30 17
27 18 13 18 46 46 37 12 40 40 38 13 12 16 24 35 32
14 35 23 14 9 11 46 14 25 16 9 37 18 23 40 53 23
10 10 14 16 42 32 40 35 42 27 32 53 53 13 13 13 8
19 24 50 9 6 8 9 28 38 37 37 39 46 32 42 13 22
53 42 40 50 43 35 13 14 7 11 28 32 40 39 29 35 9
11 14 22 40 23 23 16 14 13 38 42 37 26 8 7 11 10
25 6 23 11 19 10 9 11 20 19 11 9 12 14 14 10 11
14 38 31 38 44 23 19 9 19 14 11 34 12 8 16 19 14
31 53 34 37 33 35 35 25 29 12 34 23 10 27 11 9 9
11 39 18 16 11 14 13 8 11 11 9 8 11 11 7 9 10
6 12 11 24 42 10 11 9 14 9 10 30 25 24 25 15 6
10 9 9 6 24 8 9 34 12 9 14 14 16 10 14 25 14
9 16 11 11 9 10 10 9 9 9 9 9 11 8 19 11 9
9 23 9 16 11 12 11 6 11 18 6 11 9 9 11 14 14
20 11 10 9 9 11 6 14 18 9 9 10 10 9 9 11 33
37 16 10 9 10 6 10 10 9 12 8 14 11 7 11 9 10
6 10 11 13 13 14 13 8 10 13 9 9 14 10 8 9 9
10 14 18 17 10 12 13 11 9 19 9 11 14 10 9 11 30
9 10 13 14 14 18 9 9 11 8 9 15 9 14 9 10 11
10 6 6 11 6 11 7 11 11 8 10 12 28 6 11 10 14
6 14 11 18 6 13 11 11 11 8 12 11 11 9 11 7 10
9 11 9 10 12 10 8 10 9 11 9 11 9 22 19 14 11
13 11 9 9 9 17 10 10 9 10 11 9 9 13 16 13 9
11 11 6 10 8 11 20 20 20 16 17 17 8 9 10 14 22
11 10 9 13 10 9 17 13 9 8 11 11 15 16 23 16 9
9 9 14 11 10 13 11 10 11 9 8 11 10 10 10 6 6
6 11 14 22 9 9 11 9 11 10 9 9 16 11 14 11 23
14 14 12 8 12 11 9 6 11 11 15 11 6 6 6 11 9
8 9 11 11 11 11 9 7 8 11 11 10 11 11 9 14 8
11 10 16 17 10 9 13 8 10 10 11 16 10 10 8 11 11
11 11 14 11 11 13 14 10 11 9 6 8 11 9 11 9 11
10 8 11 13 9 9 11 11 14 14 9 10 11 11 8 11 9
12 8 19 12 6 9 11 18 10 10 6 9 11 9 9 10 17
11 8 10 10 14 9 9 9 9 9 13 11 11 18 11 11 9
9 9 6 8 6 20 11 18 8 19 12 11 12 12 9 11 12
10 16 15 14 9 10 8 11 11 9 9 12 11 9 7 10 9
8 10 11 10 10 6 9 14 11 15 11 9 9 9 11 13 6
9 7 6 8 8 6 9 9 14 12 12 12 10 16 8 7 9
6 9 9 11 7 10 9 9 9 9 10 10 6 13 9 14 10
10 11 14 11 14 9 9 10 7 8 14 7 18 27 26 28 20
27 16 17 14 12 9 12 9 12 10 13 14 11 8 11 10 8
13 20 9 17 11 12 10 13 16 17 11 13 10 12 9 10 11
12 9 14 8 8