S03036-01_E10
Seqid S03036-01_E10
Sequence >S03036-01_E10.phd
CNNNNNNNNTTTTCCAGGCNCANNANNNAGGCGATTGGCGGCCAAATCGGCCGAATTTGG
AGGCTATTTATATAAGTAAATGAAAGGGTTTCGTTGTAGCCTTTTCTGCTCTCTTCCTTC
GCTCTTCCGCATATATATTTGTGTTCAGAGATTATTCTTAAATCCATAAGAACATCCCTT
CATATAACAATTGAATAAGGAAAACACAACACATAACACATATTAAACTGATGCTTCCTG
TTATAACGAGATTTGCAAGGCCTGCTCTGATGGCCATCAGACCTGTGAATGCCATGGGAG
TTTTGAGAGCGACCAGCATAACGAAAAGGCTTTATCATCCCAAGGTCATAGAGCATTATA
CACATCCAAGAAACGTCGGCTCATTAGATAAAAAATTGCCCAACGTCGGCACTGGTCTAG
TGGGTGCGCCAGCGTGCGGTGATGTGATGAGGTTGCAGATCAAAGTCAACGACTCTACTG
GCGTTATTGAAGATGTCAAATTCAAAACTTTTGGATGTGGCTCCGCCATTGCCTCCTCTT
CATATATGACTGAATTGGTACAGGGGATGACCTTGGACGATGCGGCNNAAATTAAGAACN
CTGAANTTGCTNANGAGTTNAGCTTGCNACAGTCAAGTTGCATTGNTCTATGTAAGCGGA
AANCNCGGTAGAAGCAGAGATTTAGAGGCGCNAGGAAATNNAGANACAATCNAAACAATT
TTTNTTAAAGCAAANCAAGANAAGCGGGAGGGANANNANATTCAGNAGGGTNNTATTGTA
AAAGTGAAGANTNAGTTNANAGANAANANGCCTGNNGCANGCAAAGGATTGNATAATTAG
TAATANTGNGNTCNTACTNANATATNTAATAGNGANNTTNTNNNGAACNAAAAACATNGG
AAGTTCGGNAAGNGGNTN
Quality >S03036-01_E10.phd
8 5 3 2 2 2 3 6 5 8 8 10 10 11 10 8 9
8 9 6 10 9 5 5 8 5 7 5 8 16 16 10 12 16
9 17 28 18 14 33 24 13 11 10 11 15 26 29 31 22 31
31 35 31 17 30 41 30 34 28 33 28 21 24 31 42 32 41
32 30 42 35 37 49 42 40 46 36 37 41 34 50 46 34 35
32 42 30 31 52 43 42 35 35 32 35 28 29 28 36 49 49
54 59 59 54 35 42 42 42 42 40 50 42 38 43 42 42 46
54 43 42 43 50 54 43 49 40 35 54 50 59 50 54 50 54
54 50 54 57 57 50 53 54 54 50 39 51 57 54 45 44 50
46 42 53 51 54 50 59 59 54 54 49 29 33 50 54 54 50
53 49 57 49 49 50 54 54 50 49 50 50 49 50 57 54 59
52 50 49 51 53 53 53 53 49 57 57 51 53 53 57 53 51
49 49 49 49 49 45 46 49 49 50 54 50 50 46 49 44 54
50 49 44 54 46 46 46 46 46 34 30 41 44 46 44 43 43
38 46 49 47 50 54 50 50 49 49 60 58 42 44 51 63 49
60 49 60 54 57 44 60 60 58 50 49 49 53 51 51 50 57
45 44 50 54 54 54 49 49 57 38 53 53 57 50 57 45 51
50 50 44 50 54 54 57 57 57 52 54 49 53 51 57 57 50
50 50 54 44 50 44 44 54 50 54 54 54 50 50 51 49 54
51 53 43 37 43 50 54 49 53 51 54 59 50 54 54 50 46
42 35 57 54 57 49 46 42 50 50 50 57 54 50 54 50 49
49 49 49 46 43 49 50 51 50 45 21 49 49 57 57 54 54
54 50 50 44 57 50 57 50 50 44 57 54 54 50 42 50 51
51 51 45 45 28 57 45 44 50 50 39 57 43 50 46 46 44
57 43 42 44 54 50 57 42 46 46 43 43 50 50 51 51 39
39 44 28 44 46 32 39 54 54 54 49 38 43 46 39 50 44
21 50 36 49 44 21 49 50 39 51 32 45 50 43 49 44 45
25 43 24 21 20 38 43 42 30 41 42 42 44 32 44 49 42
38 44 42 43 43 46 42 38 46 42 42 49 46 26 44 38 33
19 49 35 32 18 14 38 39 46 36 36 33 29 31 32 30 46
45 46 43 43 44 26 44 33 47 44 28 42 27 38 24 20 34
35 47 46 40 35 49 42 35 44 47 47 44 47 39 27 35 32
40 60 42 42 42 29 42 40 25 13 9 15 10 20 18 34 46
25 35 35 35 29 40 14 35 32 16 35 32 23 27 17 23 13
8 22 10 10 17 14 9 9 5 7 21 32 9 8 9 19 42
10 9 11 9 7 11 13 13 16 16 6 11 9 9 11 9 7
8 7 24 31 14 14 11 6 11 11 13 21 20 24 9 6 10
15 13 9 9 12 9 23 12 20 19 9 13 14 32 19 14 6
14 9 11 14 11 11 9 11 11 16 18 10 15 26 20 10 6
11 6 9 8 10 9 9 10 13 11 19 14 8 9 8 9 12
10 14 10 9 11 10 20 9 12 8 11 6 11 10 11 12 11
9 10 6 6 20 11 8 6 9 9 11 9 10 10 6 11 14
13 9 9 9 10 9 17 10 13 6 10 8 16 14 10 9 8
21 11 9 7 8 10 13 9 15 7 9 12 11 9 11 10 9
11 9 8 9 9 6 9 6 7 9 6 9 8 9 9 10 9
6 8 15 12 8 9 6 6 11 11 9 9 11 9 14 11 11
9 8 12 11 9 9 9 10 7 8 6 8 8 10 11 7 15
6 9 13 15 7 14 9 6 10 7 8 11 9 11 10 6 7
11 9 9 6 9 11 16 18 11 9 9 10 8 8 10 6 8
10 13 11 9 11 17 10 11 10 18 8 9 6 8 9 6 11
6 10 8 7 10 9 11 11 7 9 6 9 10 10 9 7 9
11 14 10 11 11 6 14 13 7 6 11 18 6 9 6 6 6
8 11 11 9 5 10 10 10 10 10 10 11 9 6 9 9 10
9 8 11 9 10 10 9 7 14 10 8 7 11 9 6 10 6