S03036-01_E11
Seqid S03036-01_E11
Sequence >S03036-01_E11.phd
GNNNNNNNNNNNNNTNAANNNNNANNANANGGCGATTGGCGGCCTANTCGGCCGAATTAA
NNAAGCACGCTAATTTAATATCGATTTAAACATGAAAGTATCACAAGTTTTCATTTCTGC
CATCTCTGTCTTCGGCCTCGCTACTAGCGTAAATGCTCAAAACGCATCCAACACCACGAG
TAATGCTGCTCCTGCTTTGCACGCTCAAAATGGTCAACTACTAAACGCCGGAGTCGTCGG
TGCTGCTGTTGGTGGTGCTTTGGCCTTTTTGATTTAGGAAAAACGCCGCTTACTGCCACG
ATGATAATACCCTATTGACGTTTCTGAAATGTATAATTTCTTTTCTCATCTTCCCCTTTG
ATATTCCATCTATAGGCCCCAGAGTAATAAATTTGGTGCTTTAATTTTTTTCTCTTCGTC
CAGTTCGTCTCTATTTTTTCATTCCATTATATTTATTTATNAGTGATACNTTCTCANATA
TTCNNNTANAAGGGTATGTNAGCTATGTAACCGAATATAAGTTGATTAATAAAGATAAAC
ANGCNNAGGCCNGNNGTCTNGGGTGANGGGGGAGNAAAAAAANNAAAAAAANNANCNAAA
CNTCNGGAGNCGAGGNGANGGGGGNTGGTGTANTTANNNTNTATCNTAANAAANAAAAGG
NNGAGCGGCGGCGGCGANGCTTNTNNATGGGGTTNAAAAAAAAANACNANGNNNCCNNAN
ATCNGGNNNGGGGGGNGGCGGNNNNAGNAAAGGTTNTTNNANNATANNANNANAACNACN
ANAGTGNNNGANACATGGNAGTTNNGTAANANNNCGNNNNNNCANNNNNNNAGAAGGCGN
AAAAGGNGANNNGGNNAAATTANTAAATTATCATNGNNGANNN
Quality >S03036-01_E11.phd
10 2 3 3 3 4 2 3 6 4 3 3 5 7 10 6 10
10 5 5 7 7 5 9 3 6 14 5 8 7 10 14 9 19
18 10 22 21 11 11 21 26 9 8 9 9 6 16 12 15 15
12 10 9 9 8 8 8 12 9 7 6 10 14 24 19 22 14
17 16 19 16 26 17 21 13 23 13 14 30 18 21 28 29 26
25 25 21 26 33 12 20 31 35 31 21 17 13 18 15 21 32
23 27 28 20 26 17 17 17 12 14 17 16 24 27 19 30 38
34 20 32 27 27 31 42 50 54 50 43 49 29 35 22 29 32
39 42 42 33 35 32 37 38 33 38 34 39 42 42 54 46 46
49 50 44 42 42 43 37 46 49 44 45 43 46 39 36 33 31
42 42 54 44 44 42 36 28 33 44 34 44 46 35 49 39 43
50 39 44 49 49 49 47 43 43 34 37 51 54 50 42 37 34
50 50 44 44 49 43 42 47 35 35 43 42 43 30 30 30 29
30 35 35 35 29 32 42 44 33 43 28 28 26 23 35 18 20
27 45 22 46 32 33 30 30 35 60 60 60 50 58 49 50 47
32 33 35 42 60 44 47 22 18 37 40 47 60 60 47 47 47
42 47 42 47 44 49 45 46 46 47 49 47 47 43 60 49 50
47 47 47 50 60 47 42 42 44 60 42 42 39 42 33 35 47
47 47 47 46 47 40 47 60 57 57 57 52 44 44 46 47 40
52 42 57 52 63 42 35 40 27 40 42 42 42 28 35 35 47
35 46 41 35 47 35 27 13 18 28 22 22 29 24 22 18 20
19 19 24 16 8 12 9 10 11 13 16 20 19 19 29 31 30
35 41 35 47 42 37 42 24 52 28 28 19 18 27 22 24 35
37 43 35 35 29 45 46 45 47 47 32 32 30 23 36 23 19
25 19 35 44 27 30 23 25 29 9 13 24 22 14 23 28 34
34 27 35 35 31 28 35 27 34 35 36 27 25 25 24 24 20
23 15 16 24 19 19 42 18 27 13 19 26 42 18 25 23 38
23 6 13 10 10 10 10 9 14 19 7 8 14 18 12 10 8
6 9 11 11 11 9 12 6 7 5 8 10 7 9 11 10 12
8 8 11 8 9 10 6 11 17 19 16 11 9 10 14 8 19
10 9 9 11 13 10 14 16 18 18 9 23 9 9 8 11 20
38 29 9 45 20 11 9 23 9 22 16 8 11 9 6 9 8
6 7 9 9 9 9 8 6 8 6 6 10 10 11 9 6 9
10 9 9 18 11 6 11 9 18 16 9 14 8 6 8 11 9
18 27 35 11 6 6 20 42 48 37 14 23 12 6 6 8 6
14 7 13 8 8 9 6 9 9 5 10 11 9 9 6 10 11
8 10 16 6 10 9 5 13 42 27 23 14 6 8 9 9 12
9 11 14 6 9 14 9 5 6 7 11 7 11 9 9 11 6
8 9 9 6 8 23 13 6 25 16 16 9 12 10 6 6 14
10 11 9 9 9 11 12 9 10 9 10 9 13 10 7 9 9
9 14 7 11 7 7 8 8 10 9 10 14 10 10 6 13 20
20 25 27 16 25 14 18 6 11 9 5 11 7 8 7 5 5
15 11 5 6 11 5 9 9 11 6 9 9 7 6 7 9 9
9 8 25 13 6 14 9 9 8 11 5 5 5 6 12 8 7
9 11 10 10 10 16 13 6 10 18 7 5 12 7 6 8 10
11 5 7 8 5 5 13 5 16 11 10 7 12 9 6 11 6
10 9 8 10 5 5 6 9 9 6 9 11 8 9 9 10 7
11 11 11 11 5 7 13 11 12 13 5 11 6 6 6 8 11
5 5 5 5 5 5 8 11 6 7 5 5 5 5 5 10 9
10 9 10 9 9 8 7 13 9 9 9 13 15 5 14 11 6
6 6 11 8 6 6 9 11 10 17 16 11 6 8 8 11 21
9 18 23 9 9 23 14 7 9 6 6 23 9 6 6 5