S03036-01_E14
Seqid S03036-01_E14
Sequence >S03036-01_E14.phd
NNNNNNNNNNNNNNNNAGGNANNNNNNNANANGGNGATTGGCGGCGNATCGGCCGAATTG
GAGTCGAGAATAATTATGGCACCCAGAAAACGCTTTAGGCTACTCGAATTAGGGTCACCA
ACACATTCTAAAAGGAAAGTTCAAAAACCTCTTCAAGAGAAGACCCCAAACTTGCGAGTT
TCTCCACTTGCTTCTAAAATTGGTAAAGAAATCAAGAATAAGGAAATCAGAAAAACAAAA
AAAACAGAATCAGAAAATATATTCAATTCGAAACATGTCGATTTAAGACTAGAAAGCCCA
CATCCAGGATTAAATTTTGTAAGTGATGCTCAACAGTACTCAAAGGCTGGAGATGTTCGA
TATTTGAAAAATAAATCAAGCAATACCTTGAAAAACGAAAGACAAACAATAGAGCGCCCC
TCATTTGATAATTCCTTAAGGTTCGAGGACATTGAGCAGCCTCCAAAATCTACTTCAACG
CCGGTTCTTTCTCAATCTTCTCAAATAAATGTAGAAAGAGAAGCGCCCATGTTTCCAGTT
CCTTACTATATTGCTCCTTCTCCTATGTATAATTTTAGCCCGTATCAAAANTTCNTTNGA
AANCCAACGTNNNTGACGCNAANGTCATAAGCCAANGNTAAACTATGGCNTTCCCATTCA
ACGGCCGGAATTACTTTAAAAAGAATGNTAACGTATAACGAATTCGCCNNTGTTNGAGNN
AGNCAGACTGCCANATCGANNCAAAATCAGCATAACAGGGGAGGGAGGAGGAGGGGTGNG
GGAGANNAGTANNTNNAANNTTNNANAGTNGGATATNATGCCCCAGGCGGATGAANGTNG
CAAGGGGGGNGAGAGANAGTNGGNCGAGNCNCATCCANNTGTGCNCCTCCTACGGGCGGG
NGGGANGTGTGAGGGGGNNAGNNATNNTNGANN
Quality >S03036-01_E14.phd
6 4 3 3 3 3 2 3 3 3 5 6 6 4 4 6 8
8 8 6 8 7 5 7 7 5 5 5 21 6 8 7 10 10
5 11 15 12 17 27 12 14 29 17 9 9 6 15 26 27 34
25 28 28 26 18 11 21 25 20 14 15 19 24 30 31 35 28
32 16 28 26 28 28 29 29 24 30 27 31 38 31 46 32 32
26 30 28 24 31 28 42 43 49 40 29 34 27 27 35 31 28
32 42 49 37 42 46 42 42 30 31 53 31 28 31 26 23 23
26 26 28 26 26 18 27 31 40 38 35 40 46 46 43 49 42
46 50 54 50 50 50 37 35 42 54 42 43 46 49 51 46 45
42 35 50 45 42 35 42 47 43 42 27 51 51 51 54 43 46
40 46 49 50 54 49 43 42 51 46 42 43 47 50 50 35 50
46 42 45 49 49 51 44 45 42 51 51 53 44 49 57 50 49
50 53 53 43 57 46 46 44 54 46 44 49 50 49 50 50 43
44 50 36 21 20 43 43 27 28 31 38 43 43 35 44 32 26
33 20 17 20 17 19 23 22 42 42 20 27 43 35 42 49 35
32 47 60 60 57 44 43 43 42 35 43 45 49 60 49 49 49
60 49 42 45 60 60 60 58 50 50 51 49 28 47 49 51 39
49 44 49 50 51 49 49 39 46 43 39 46 42 49 49 45 36
50 51 44 36 47 42 43 43 44 49 49 46 45 36 39 46 43
49 46 33 21 51 38 51 49 44 45 46 50 46 49 46 46 46
44 39 45 43 43 51 25 49 43 43 44 39 39 28 50 42 43
49 43 46 44 49 44 46 44 44 32 27 32 43 44 37 42 44
41 44 50 46 42 45 49 50 54 54 54 49 46 49 49 49 44
46 43 43 46 42 46 49 50 49 54 43 33 42 49 54 54 30
51 49 49 38 51 49 49 50 42 51 45 46 50 43 54 50 54
50 54 50 50 42 46 38 49 39 46 40 45 39 42 43 51 24
46 35 40 40 45 53 42 31 33 42 49 49 49 42 54 54 50
38 49 49 40 46 33 50 45 46 43 54 50 54 50 54 49 40
26 15 39 42 35 35 20 42 20 49 39 27 49 46 42 43 35
35 30 35 43 42 43 35 39 35 39 29 41 35 33 39 31 33
50 33 31 37 15 42 50 42 43 25 46 49 28 42 35 27 21
32 28 39 46 40 20 20 24 26 19 26 19 29 26 29 26 42
32 32 28 40 19 32 24 29 42 19 31 31 29 22 42 31 24
35 42 20 35 37 42 20 32 32 16 29 18 32 24 24 24 25
18 18 18 30 11 11 11 11 27 10 11 11 7 39 20 18 7
17 17 7 13 14 18 13 7 19 29 29 18 19 29 17 7 5
6 9 11 10 11 12 8 7 8 9 7 9 10 12 11 25 18
12 9 11 11 11 10 6 8 6 9 9 11 12 11 11 27 34
15 9 10 6 10 8 9 16 17 11 16 10 10 16 20 27 24
32 28 29 20 24 23 11 9 22 11 13 18 19 16 15 18 10
11 8 9 22 10 15 11 6 16 10 13 9 12 9 16 10 11
21 13 16 20 10 11 16 16 20 9 24 7 7 13 16 9 19
6 9 22 11 6 6 11 10 6 8 18 9 19 10 18 28 11
8 9 6 9 21 14 9 16 6 6 8 21 21 10 9 10 14
9 10 11 15 11 15 14 10 10 14 9 9 9 11 14 9 9
11 30 11 10 8 19 11 14 12 13 9 11 9 6 9 17 10
10 8 9 7 6 10 11 9 9 6 6 8 6 6 10 10 6
6 9 12 6 6 9 6 12 11 9 6 9 8 11 10 11 9
6 10 8 11 9 9 13 12 10 15 24 9 11 13 8 8 9
9 8 6 14 10 7 12 9 8 9 14 11 16 14 16 10 6
9 9 9 11 9 8 6 10 11 14 7 10 14 7 11 10 13
10 6 9 6 9 9 11 10 10 11 6 6 12 9 10 11 9
7 8 9 11 9 11 9 10 9 8 11 11 9 8 9 8 5
9 8 8 10 6 9 9 10 11 9 8 9 8 10 9 11 6
6 8 8 5 7 9 11 6 7 8 6 11 11 6 5