S03036-01_A12
Seqid S03036-01_A12
Sequence >S03036-01_A12.phd
NNNNNNNNNNNTNNTNGGGANANAANNANAAGNNGATTGNNGGCNNNTCGGCCGAATTGA
ACAAGAACATAAAAAATTGTTTTTGCTACATTGGTTTCACATAACATATTTCAACAAACA
TGCCATCAAATTTGAATATAGTGAAGGTTACAAAACCACAAGAAGAAAATAAGAATATTT
TACACAAAAACACGAATGAACCCAATGAAATGGAACAATCGCAGACACAAGAAGCAGTTA
CAGAAAATTTTACCGAAAACAGTAATCTCAGTGCAAATGAACATGCAGCTAGGAGGGGTA
GATTAAATTTGAAAACAGTTGATCACATAGAAACTTATCCAATAGTGCAAGAAACAGAAG
AGATTGCAAAAAAGATTGCTCTAACGAGAATTATTTTAGCACAAACAAAGCCTAGAATCG
ATAAAGTGGTAGTGTCACGTCCCGTTCAAGCCGTAGCACCAGTGGTCAATTTTTTTGACA
AGATGGCCAATTCGACTTTAAGTACAGTAGAACGCGATGTTCCTTCTTTGGAGAAAAAAA
ACTGATAAAAAGAATAAGTGAGGAAATTGCGATNCANANTAATTTAGTCCATAAAAAATG
GCAGGCAGCGCCGGGNAAGGGGAAGGGAGAAGAGGAGGACACCTAAGTATAATGGAAAGG
TNGGGGGGAAGNGGATGAAATGGAGGNGGAGGTATAAGGGAANNTNGAGAAGAATGGAAA
NCAAANNAAAAAACGGCGCGAGNNGGGGGCGGGGGGGGAGGGGGGGAGGGGACNNGGGNG
NGGGGGGCGGGTAGACCTAGTTNTAAGAAAGGAGNAAGAAAAGAAAACAAANGGACTAAT
ANNGAAAAGNNANGAAAAAAAAAAAAAGAGAGAGGAGCGGCGCCCCTTGGAAGAGGAGGA
GGAAAGAGGGAGGGGAGGGGAGCCCAGAGN
Quality >S03036-01_A12.phd
6 3 5 4 4 4 4 5 3 5 6 8 6 5 9 7 23
15 9 8 7 8 7 8 10 7 6 14 6 10 9 10 7 6
15 14 11 15 13 7 6 16 17 9 6 6 6 25 20 36 28
21 17 19 20 9 40 24 17 10 15 19 15 17 28 33 22 35
16 35 26 26 28 35 49 29 18 27 30 31 35 37 42 42 39
28 21 24 37 27 35 43 42 28 35 33 32 39 22 43 28 31
31 27 36 27 27 27 27 29 27 32 28 31 42 27 24 33 44
35 42 44 42 31 39 60 44 28 39 42 47 60 42 42 42 42
60 44 42 27 44 42 60 42 47 47 51 50 50 60 49 49 50
58 51 49 50 50 50 39 42 42 43 42 50 49 49 49 49 49
42 39 42 50 39 50 54 50 49 46 44 49 54 50 50 50 59
54 51 51 54 59 50 44 44 51 51 53 51 51 50 51 51 44
50 49 49 50 50 49 47 57 50 54 54 54 42 54 50 51 49
54 59 54 50 50 42 50 42 42 42 46 42 46 46 43 46 46
43 30 35 22 42 39 29 35 43 46 49 49 47 50 50 50 46
49 42 42 43 54 38 54 50 42 54 54 54 50 50 50 54 54
54 54 54 57 50 39 49 49 54 42 50 46 50 54 54 50 50
50 50 51 49 45 28 57 59 54 50 49 46 44 36 50 42 42
44 44 49 44 46 44 44 43 43 42 43 49 46 49 50 50 35
49 43 46 49 49 50 39 49 50 50 42 50 54 39 50 42 47
24 47 60 60 31 42 60 44 31 42 60 47 42 47 47 32 40
60 54 44 50 35 34 18 49 49 42 44 44 44 44 40 47 60
42 38 60 52 46 52 57 60 44 39 35 29 34 39 47 35 42
57 33 35 57 60 57 57 57 52 28 42 46 52 60 46 47 52
57 46 46 47 46 52 24 52 57 47 59 46 47 47 46 52 60
60 60 54 42 46 44 31 60 52 46 44 26 46 60 52 44 47
46 60 47 53 45 46 46 36 35 31 36 23 27 11 20 27 53
53 46 17 19 35 25 31 24 13 46 46 53 53 41 41 41 40
34 9 16 18 24 46 46 24 34 32 19 23 23 46 26 34 26
18 27 13 14 19 18 14 27 19 15 10 10 9 15 25 17 19
24 12 13 11 20 10 10 14 42 27 17 35 30 32 32 35 34
32 32 11 18 27 13 17 16 14 15 32 32 34 27 12 8 14
14 20 27 32 31 32 30 19 18 22 12 16 10 12 17 19 15
9 26 46 46 14 14 19 11 9 10 11 23 7 8 9 7 9
7 9 16 19 16 15 11 9 10 14 12 11 14 14 20 27 17
11 12 11 14 10 10 11 11 13 12 11 8 10 14 20 11 10
10 17 14 7 11 10 10 10 17 16 14 11 18 15 17 10 18
9 9 12 12 19 32 15 15 15 24 20 21 12 11 14 11 11
12 13 15 14 20 17 13 11 9 9 15 16 11 13 10 6 14
9 13 19 20 22 14 11 24 7 10 14 17 12 14 20 20 15
11 14 13 13 11 12 6 11 17 13 12 13 8 10 8 18 9
11 13 22 15 14 6 6 11 6 9 14 15 9 16 11 9 28
10 9 9 9 11 11 6 11 14 19 9 6 6 19 28 20 18
15 13 9 11 13 19 14 11 19 14 10 7 7 15 20 14 24
17 16 11 12 20 16 16 27 18 17 16 14 14 13 11 8 10
12 14 18 18 18 14 9 9 7 7 20 24 8 6 9 6 17
9 11 13 20 12 8 15 19 24 17 16 12 11 8 15 11 11
14 11 9 6 13 17 15 17 10 11 9 12 9 11 9 7 11
10 11 22 10 20 20 20 32 15 18 10 10 8 22 9 5 14
10 10 9 8 8 10 10 20 6 6 14 9 20 14 15 21 7
6 10 6 19 14 27 19 32 19 28 16 15 11 28 27 20 17
18 17 19 14 13 17 20 24 20 20 28 24 18 17 11 14 20
23 18 17 24 19 24 20 17 24 20 17 13 16 38 16 10 10
10 19 24 13 19 17 11 8 14 20 11 9 10 14 18 18 27
24 16 14 11 9 14 10 11 19 19 11 7