S03036-01_E15
Seqid S03036-01_E15
Sequence >S03036-01_E15.phd
GNNNNNNNNNNNTNNNNNCNNNANNANGGCGATTGGCGGCCNNTCGGCCGANTGATCATC
AAACAAGCAACTACAAAAAAGCTTTACTGACAACTCACACAAATAACACAAAAAACAAAA
ACTTCAACAATGGTCGCCTTTTTAGAACTAACTTCTGACGTTTCTCAACCTTTTGTCATC
CCATCTCTTTCGCCAGTCTCTCAGCCAAGCTCAAGAAAGAACTCTGACGCAAACGTCGAT
GACCTGAATCTGGCTATTGCCAATGCCGCTCTTTTGGATGCCTCTGCTTCAAGCCGCTCA
CACTCCAGAAAAAACTCTTTGTCTCTGTTGTAAGTGTTGTACACGAGAATTAACACACTA
TTAGCATAAAAGACATTTGGCATCTTTACTTACTTGGGCAAGTAAGTCACGTACTTTTTT
TTTTTTCCGGAGCATTCATTGTCATTCTATCTGCACTTTCCCGCACTTACATTCAATAAC
CTCGGATCGGGTCTCTTCTACGACAGAAACTTTTTGATATATACATATTTATGCAATATA
AATACTGAGAAAGTAAAAAAATTTAAAATATAAAATAATAAAAAAATTTACTATCTCTCT
CCCCCACNNNCANNGGNGAGGAGGNGNNTNTTAANGTTTTTATANNTNAAANATGTTTCT
GGCCATAGGGCNCANCTTNGAGTTTNNNANANNNNACGAAAAANCATAGCNAAAANANGA
NANCACCNCTCTCCCGAGNGAGAGNGGAGAGNGGNTGCANAGNNGATAATATTTAAGNTG
ATGNANANNATAGAGNAGAAGCCTGGNGAGCCCNNNNANGGGCANNNGAAAANTAANAAN
NANNNNNAAAAATACNCTTTNNNANNGNNNACCNNGNNAGGGAAGCAGGNNANAAGAANN
GNCGTCTANAANNTNATCNACNNAGN
Quality >S03036-01_E15.phd
10 5 5 3 4 2 4 4 4 7 4 6 8 7 6 7 6
6 9 5 3 3 8 7 6 8 6 12 16 10 24 18 10 13
19 12 12 30 27 16 11 7 5 26 21 22 22 18 16 16 10
7 23 17 9 16 18 21 25 20 27 27 23 29 19 23 18 23
31 28 26 20 31 37 18 28 34 31 27 27 21 28 21 21 25
25 30 30 37 17 30 10 12 36 28 43 18 34 28 28 19 21
16 15 16 22 26 21 21 17 16 21 21 25 30 28 34 33 32
30 32 50 49 43 31 24 27 29 29 27 43 49 28 35 46 42
42 46 49 49 46 46 32 29 40 49 59 33 43 42 43 45 53
43 46 49 46 43 43 46 40 46 46 54 54 49 35 35 49 46
42 47 43 43 46 49 46 42 49 49 49 38 42 57 51 49 49
46 43 45 53 43 50 43 34 51 45 49 51 51 49 49 43 54
51 44 30 49 44 46 49 49 36 30 37 44 39 42 42 54 39
44 47 47 47 44 33 27 27 35 29 22 24 20 24 27 19 19
23 26 35 44 27 32 44 44 41 41 60 57 60 57 44 34 41
47 52 57 52 52 44 42 57 60 57 52 57 42 45 52 57 57
60 60 60 57 57 52 31 52 44 57 57 57 57 60 43 46 57
52 52 52 57 57 57 52 42 52 57 57 57 60 44 57 47 35
52 57 63 63 63 63 43 43 52 60 60 60 60 53 63 63 57
63 57 60 63 58 60 53 60 57 52 57 57 52 52 48 48 47
60 60 42 43 47 52 48 48 52 52 57 46 41 47 47 40 20
24 32 40 40 40 40 41 40 47 60 60 47 57 57 57 52 57
57 63 63 57 57 52 60 60 60 57 57 60 52 52 52 57 57
60 57 57 58 57 60 58 57 60 58 60 52 57 58 57 60 60
52 52 43 43 57 57 60 60 57 60 60 60 46 63 60 60 57
57 47 60 52 63 52 42 57 57 52 60 42 52 52 60 52 47
52 47 47 57 52 60 49 42 60 47 54 47 47 47 60 43 32
23 19 20 27 35 27 27 35 60 42 47 35 40 39 35 35 42
42 47 60 60 47 44 39 43 46 28 16 19 29 49 49 16 39
35 42 35 39 39 42 39 43 27 49 42 39 39 50 27 30 32
37 49 46 49 54 42 43 19 37 21 29 16 27 26 30 27 37
26 29 27 34 27 32 18 21 28 16 27 16 30 30 27 26 24
30 21 27 22 22 30 21 27 32 21 12 12 26 26 27 30 30
29 30 31 27 35 28 32 18 16 20 27 31 30 35 19 28 28
28 26 28 27 32 34 21 12 10 23 26 20 29 16 13 32 8
11 23 9 16 19 19 12 12 19 10 11 10 7 6 6 9 12
6 6 9 10 7 14 11 16 13 12 12 10 7 9 7 7 10
6 11 11 10 9 6 10 17 17 19 32 11 13 19 8 6 6
13 6 9 9 8 5 12 10 11 11 14 14 21 8 22 19 11
11 10 12 14 12 30 11 8 7 12 15 6 9 16 15 7 12
12 12 9 12 21 7 6 7 10 7 9 5 3 3 7 12 10
9 11 15 23 10 11 5 9 10 12 10 13 9 6 24 12 28
9 7 10 6 14 12 7 9 7 11 11 14 14 6 8 10 12
12 22 19 12 10 8 12 7 10 8 13 10 15 7 16 16 8
13 8 11 7 26 10 7 9 9 9 9 6 8 8 6 6 12
9 16 14 9 11 8 11 10 27 9 8 9 6 12 12 15 8
16 6 16 7 13 6 6 16 11 13 9 24 16 6 11 10 13
15 18 10 13 8 17 13 7 10 10 10 10 9 12 7 7 7
7 16 6 12 12 18 10 9 7 3 5 12 10 14 10 15 7
10 26 23 7 17 24 5 3 8 7 7 5 5 5 15 27 27
24 18 8 10 8 7 13 14 19 9 6 6 5 9 6 6 9
6 5 5 8 11 9 6 7 8 6 6 13 14 14 18 11 9
14 8 12 15 18 5 6 10 6 10 9 15 11 16 6 7 12
7 16 13 19 10 10 9 7 29 22 5 5 9 7 10 10 9
6 10 9 5 5 10 9 6