S03036-01_E18
Seqid S03036-01_E18
Sequence >S03036-01_E18.phd
NNNNNNNNNNNTTTNNGGNNCGANNNNNGGGCGATTGGCGGCCAAATCGGCCGAATTGAT
ACTTAAAAGTTCAAATCAAAGAAACATACAAAACTACGTTTATATCAATTAATAATGTCT
GAAATTCAAAACAAAGCTGAAACTGCCGCCCAAGATGTCCAACAAAAGTTGGAAGAAACC
AAAGAATCTTTGCAAAACAAGGGCCAAGAAGTAAAGGAACAAGCTGAAGCTTCTATCGAC
AACCTAAAAAATGAAGCTACTCCAGAAGCTGAACAGGTGAAGAAGGAAGAACAAAACATT
GCTGATGGTGTCGAACAAAAGAAGACCGAAGCTGCCAACAAAGTTGAAGAAACTAAGAAG
CAAGCTTCCGCCGCCGTCAGTGAGAAGAAGGAAACCAAGAAGGAAGGCGGTTTCTTGAAG
AAATTGAACCGTAAAATTGCTTCCATTTTCAACTAATCACACTTGAATGTGCTGCACTTT
ACTAGAAGTTTCTTTTTCTTTTTTTAAAAATAAAAAAAGAGGAGAAAAATGCTGTTTATT
CTGACCTTTTACATAAATTTTTCTTAATTGTATCTATCTAATAACTAATCAATATAATAA
TAATAATAATAATAATAATNNNNATGGNGNNGNNNNNANNTNNATNNNTNNNNNAANNNN
AANNNGTNCCGGCCATAAGGNNNNGCTTGAGTATTCTATAGTGTCACCTAAATAGCTTGG
CGNNNNATGGCCATACCTGNTTNCTGNGNNAANTGGNGNNCGGGNACNNNNCACNCATNA
NNCNAGCGNAAGCANAANTGNAANCNNNGTGCTANNAGTGANCTANTNNNTAATAGAGTA
GNNNNNNGNNCNNNNNNCANNGGNAAGCGGGNGGNGNNGGTGGNATAANN
Quality >S03036-01_E18.phd
5 3 3 2 3 2 3 5 4 5 7 9 8 8 7 7 9
9 7 5 9 8 10 5 5 3 3 5 10 24 21 9 25 29
15 42 32 12 16 35 27 17 23 12 20 25 42 30 32 21 35
41 35 28 18 29 37 35 13 26 30 29 38 31 41 41 36 40
40 49 49 30 36 34 49 41 37 35 45 37 41 43 40 36 29
11 17 13 19 15 25 46 51 49 43 44 49 32 37 40 35 46
46 43 46 42 35 35 40 42 31 33 33 36 35 28 19 32 46
46 49 45 40 49 47 49 43 35 46 49 49 54 50 49 49 49
49 49 49 51 49 49 50 54 57 54 49 49 59 57 47 45 46
45 39 50 59 57 43 30 45 53 51 54 49 49 49 49 54 54
51 46 51 54 49 57 49 49 43 50 50 49 52 50 57 50 52
59 53 53 43 53 53 46 53 53 53 54 50 51 53 53 53 43
43 49 53 53 53 49 49 54 54 54 49 49 51 57 42 49 46
49 50 54 49 46 51 49 54 52 57 49 52 50 49 46 49 50
42 40 32 40 46 46 50 54 50 49 54 54 52 43 57 53 51
50 57 50 50 50 59 59 50 40 50 57 50 50 54 54 57 53
49 50 54 51 53 54 57 57 57 54 57 53 50 57 57 57 54
57 50 54 54 57 57 57 59 59 52 57 53 53 53 57 57 38
49 50 50 57 50 49 49 51 53 50 54 52 57 57 54 57 53
54 54 23 57 57 57 53 43 53 57 57 50 51 54 57 54 42
52 49 49 50 50 54 51 50 49 45 45 46 49 54 54 50 49
51 50 49 54 40 26 46 49 46 46 46 46 50 36 49 49 54
57 54 54 49 46 49 57 54 52 38 57 57 37 57 51 35 51
49 49 49 32 46 37 57 54 57 57 36 57 50 57 43 50 38
54 53 35 57 57 54 54 53 57 50 57 43 49 49 49 42 51
57 54 54 49 51 49 54 54 57 57 54 46 54 49 49 46 46
35 49 35 59 57 53 53 43 32 57 54 50 42 53 43 49 54
54 54 54 54 57 49 51 49 35 52 32 49 46 46 50 35 35
46 46 42 31 43 46 36 46 46 50 49 43 40 42 40 40 39
35 41 35 42 40 40 42 32 31 41 46 50 33 51 49 47 51
35 43 53 51 51 49 49 49 49 52 18 49 53 23 53 53 47
53 46 32 50 42 46 52 28 49 49 49 32 53 46 46 49 42
30 46 37 49 49 49 42 46 32 46 29 49 49 37 51 43 34
43 40 34 46 28 28 33 53 44 49 36 36 42 46 36 49 36
46 42 53 40 30 40 49 42 31 49 46 31 16 50 41 40 41
35 32 33 28 19 21 23 26 22 16 15 22 12 12 20 11 17
24 15 20 20 10 11 11 4 3 5 5 11 15 9 11 7 9
6 7 9 5 5 6 7 5 16 6 5 9 7 7 9 15 6
6 5 9 6 7 3 5 7 11 10 6 5 6 5 12 15 6
7 5 17 30 6 31 10 12 23 14 21 17 21 25 13 27 19
7 3 7 5 16 29 12 18 40 24 31 22 13 20 33 29 22
21 12 11 12 10 29 10 31 9 29 23 10 14 15 11 15 13
9 14 10 11 30 22 15 9 5 7 5 7 11 19 17 14 9
16 9 11 12 10 21 14 9 5 8 9 6 16 10 13 6 11
6 7 8 8 5 9 20 18 7 10 7 6 11 12 13 9 6
9 9 6 3 5 5 23 9 10 6 9 8 9 5 9 5 5
9 7 13 9 20 8 5 13 22 12 22 11 7 8 30 6 13
16 7 25 10 5 12 5 7 5 18 8 13 18 8 19 5 5
14 13 8 10 14 5 8 11 15 6 8 7 3 7 9 14 16
14 9 9 13 9 9 8 8 6 7 6 5 7 7 10 7 6
11 6 6 7 7 5 6 23 9 5 5 11 11 7 10 14 10
9 9 16 14 6 13 10 6 16 6 6 16 9 12 9 10 6
10 17 11 10 6 7