S03036-01_E20
Seqid S03036-01_E20
Sequence >S03036-01_E20.phd
NNNNNTTTNNNNNNNNGNNANCNNNNNAAGGCGATTGGCGGCNNATCGGCCGAATTGAAG
GATAACAAACATCTTCTTTCGTTCGCTTCAAAATAACTACAAATTAAAAATGCAATTCTC
TACCGTCGCTTCTATCGCTGCTATTGCCGCTGTTGCCTCCGCCGCTTCTAACATTACCAC
TGCTACTGTCACAGAAGAATCTACCACTTTGGTCACTATCACTTCCTGTGAGGACCACGT
TTGTTCTGAAACAGTTTCCCCAGCTTTGGTTTCCACTGCTACCGTCACCGTAAATGACGT
TATCACTCAATACACCACCTGGTGTCCATTGCCAACCACTGAAGCACCAAAGAATACCAC
TTCTCCAGCTCCAACTGAAAAGCCAACCGAAAAGCCAACTGAAAAGCCAACTGAAAAGCC
AACCCAACAAGGTTCTAGCACTCAAACTGTTACCTCCTACACTGGTGNCGCTGTANNGGC
TTTGCCAAATGCCGGTGNNTTATTGGCTGGTGTTTACNCTTGATAGGAAGAAAAANACTT
AAGAGTACCNAAANNAAAAAAAATAAANAAAANAAGNNGANCCAATNNTCCCAACCANAT
TANGANNGACCCGTGNAGGTGTGGGAGAAAGAAANTTCCTAATTTCANAAGAGGATAAGG
NCCCGGGCCGAAGAAAACAGNATTGAATATAAAGGTATAATGGGGNGGGAAGAATANNCG
GCCGGTGNTGANNTNTTGANAATTAAAAAAGGAGGACTGGGTAAAAGGNGGNNTGGGGAT
GGGGGANCAGCAAAAGGANGGGTATCCTGCGCAAGTGGNGCGAGNNAGAANGGNAANNAA
GNAGAAGAACGNGAAACACNGCANTCAGGGACTNAGATNGGGCCCAACAAAAGANCAAGN
NNNGAGCTAN
Quality >S03036-01_E20.phd
5 4 2 2 3 9 12 8 6 5 5 5 3 5 5 6 9
3 5 8 5 8 5 7 5 7 7 10 9 11 9 9 23 27
11 29 31 14 19 26 25 12 7 7 9 11 34 30 31 35 35
36 35 13 28 40 35 22 22 27 50 14 10 29 37 37 31 30
39 27 36 36 39 44 47 44 42 38 42 47 46 46 47 52 27
52 60 52 46 19 23 41 34 37 27 35 52 46 41 52 32 42
47 47 42 39 47 46 46 47 46 52 53 47 46 45 53 41 30
35 39 60 52 60 57 57 57 60 57 57 57 58 52 52 60 54
47 52 52 60 57 52 52 53 53 57 52 60 52 52 52 52 57
57 57 57 57 52 57 60 60 57 57 60 52 57 57 57 52 53
60 60 57 52 48 57 57 53 52 57 52 57 60 52 57 52 57
54 57 52 57 57 52 57 58 52 47 52 52 52 63 52 63 53
52 52 52 57 60 52 52 48 57 57 57 52 52 52 60 54 60
52 60 59 60 52 60 57 52 58 58 42 57 52 35 40 40 40
34 40 23 32 57 52 43 48 47 60 57 60 52 60 52 57 57
48 48 60 57 57 57 60 52 57 60 60 63 52 63 60 60 53
60 52 39 52 52 57 58 57 52 52 53 43 48 57 47 48 48
52 52 60 57 60 57 57 52 52 52 57 57 48 48 57 60 57
60 52 46 60 48 40 52 52 52 48 60 48 48 57 52 43 48
57 52 40 48 40 52 57 60 46 48 41 52 42 48 40 48 43
35 48 48 47 48 40 40 48 22 15 28 39 43 23 33 46 52
48 40 52 60 48 60 52 40 43 29 32 47 52 52 52 19 31
40 40 34 48 57 57 48 35 42 52 42 57 42 52 52 52 48
43 48 22 52 52 33 60 60 57 52 48 39 60 48 25 40 52
46 60 57 54 52 48 48 40 32 47 39 47 42 52 60 52 60
46 46 46 44 57 52 57 24 57 60 52 52 39 20 9 23 40
40 32 40 60 57 43 43 34 48 39 32 31 31 41 35 42 29
23 18 22 28 27 11 14 22 6 11 9 29 37 35 11 9 7
7 10 17 13 22 25 19 18 14 19 22 10 10 12 9 12 12
12 29 24 16 6 7 19 18 10 9 27 11 23 12 16 26 23
18 18 11 15 10 11 12 6 11 9 9 11 9 8 11 18 13
9 9 10 9 29 23 27 14 7 14 13 10 9 14 20 11 9
9 10 8 9 10 6 11 16 16 7 6 17 10 23 10 8 13
18 9 14 32 24 12 6 13 17 13 9 6 9 11 8 6 6
9 11 6 9 11 12 13 13 6 7 9 15 11 13 11 11 9
10 11 6 10 12 11 14 7 10 9 7 6 8 9 11 9 9
9 10 9 6 18 15 11 11 12 11 11 12 12 10 11 11 12
19 10 19 9 11 7 9 13 11 14 14 14 18 11 11 14 10
9 7 24 13 10 9 11 11 16 10 14 11 14 11 6 9 10
9 22 14 12 10 15 8 18 13 12 10 9 10 11 13 11 14
6 9 21 13 9 12 14 8 10 25 14 18 13 11 15 10 11
12 16 10 9 15 11 9 11 6 11 9 10 14 11 10 10 17
13 19 7 6 8 10 11 16 13 10 16 8 9 7 16 10 9
6 6 10 7 10 8 11 9 7 12 34 12 11 26 24 13 17
18 11 13 11 11 19 10 10 11 11 9 11 14 11 10 12 11
14 10 9 7 13 10 6 6 11 9 10 18 22 11 9 26 15
14 16 14 11 6 8 10 12 10 13 19 9 12 10 11 10 6
9 9 11 20 13 10 9 9 10 9 11 11 8 10 11 9 9
14 9 7 14 10 9 9 24 6 6 8 11 10 11 7 9 9
6 11 8 7 6 10 10 9 6 9 8 8 9 14 8 10 8
9 6 9 8 9 11 9 10 10 6 11 11 10 6 11 10 9
10 9 11 10 10 10 6 12 10 14 9 6 9 11 9 10 10
10 8 11 11 9 9 19 9 8 10 6 10 16 9 11 6 6
6 6 8 13 8 9 11 8 6