S03036-01_E24
Seqid S03036-01_E24
Sequence >S03036-01_E24.phd
NNNNNNNNTNNNNNNTTAGNNNNTNTCTATGGGCGATTGGCGGCCAATCGGCCGAATTGA
CCACTTNTACCNGCATCTAACATTGCTACACATAACTNANGAACAACGCCAAGCCAGTAA
CTAGCACGAAAGGAAGGAAAGTAAAGTTATGTATCCCATTCTCTTTTTNGATTCTTATTG
AAATGTTAGGATTATATCTATCCTCCCTTTTCTTCCCCTTTTTTATGGCACAGGTGTTTG
CTACCAAATACTCACTTACTTTTACTTCGGATGAGTATGAAGAAGATGAAACAGGACAAA
ATGAACCTGGTCCTTTAGTTTTGNTTTGGATAAAAACTCATTACCACCAGCTCTGCTAAA
TCAAATGGAGTTTAATCCATACTTATTGTTATCCCATTTACCGCAGGAGCCGCGAGCTGT
TGATTCTCANGAACATACCGATACGGTCCTTGNTTCCAAATCTGTTATAGATTTTCTGTT
GGAAGATCCTGTAANAATAGTGAAGCACAAAAAGTATTGAAAATTNAAAGTATTGGGGGT
GGANTTNNGAAANNTAGAAACNNAANAAGAACGNNATCAGGCTCCAACCTACANTACGTA
AGGGAAGGNAGAGAGAAATGGAAGTATGNNATNGAATATATTGNCGAAGATATGAGAAGA
ANTTCCTANTTCNGCTNAACGAANNGANNCNNNGTNCAANNGTANATACCCGACCGAGNA
NAAAANANTANACGAAAATGTATTTTGTATTTTGTCTAGCTGAGGGAAGAGGAACAGGNG
CGGNAGNGCGACTNTGANNAAGTAGATNTANNGGGNTCGATTAAAAGACCGTGTNGTGAC
TCCTTAATATAGGN
Quality >S03036-01_E24.phd
7 6 5 2 4 2 3 3 8 5 5 7 7 7 7 8 9
8 8 7 3 5 5 9 7 9 9 8 8 8 10 29 24 12
25 19 18 31 41 21 17 41 20 12 13 10 9 46 49 45 22
30 46 43 28 26 26 35 40 18 9 9 19 16 10 10 7 10
9 10 10 7 10 14 22 17 39 26 8 9 22 15 22 12 12
24 10 17 18 22 29 9 15 10 10 9 9 6 9 7 10 14
19 19 9 11 15 16 19 18 23 28 15 11 13 10 19 19 11
12 15 11 10 9 9 9 13 10 9 11 11 10 28 23 35 14
21 12 10 11 11 11 13 12 10 10 11 9 9 10 14 10 10
13 11 12 16 15 19 23 17 12 16 12 13 18 24 11 7 13
9 13 16 19 11 11 13 13 12 22 12 9 18 18 14 16 22
11 11 22 17 12 11 11 27 10 13 14 10 13 16 18 24 14
20 13 9 10 10 10 9 11 24 19 39 11 11 18 15 9 10
11 11 10 10 17 19 31 33 24 11 23 9 11 14 34 15 13
20 13 10 12 39 29 24 29 9 15 15 18 14 14 19 23 15
18 27 11 22 32 34 42 34 13 24 13 15 19 13 36 39 13
19 24 27 14 26 13 13 20 29 11 10 10 10 28 28 35 18
31 13 18 10 8 21 13 14 11 19 10 9 11 15 19 9 13
28 13 19 23 10 13 15 14 11 14 18 11 13 14 13 10 10
7 12 15 19 31 24 27 28 12 20 16 12 10 19 13 14 8
15 23 26 28 12 9 19 17 15 13 13 11 10 10 26 16 26
9 17 13 9 9 9 12 26 14 24 17 19 13 22 41 27 22
19 26 21 18 19 13 11 18 35 53 23 11 23 11 11 24 9
8 13 13 18 32 19 15 35 29 27 19 13 11 28 13 19 17
15 26 33 18 17 10 16 24 28 28 34 20 12 16 11 13 15
17 13 11 13 7 13 25 21 44 37 23 13 18 18 11 11 15
9 23 13 27 18 30 23 19 16 13 6 13 18 13 18 11 18
18 19 13 13 44 18 21 33 42 35 14 40 23 17 28 28 24
27 39 14 19 27 14 16 9 9 20 11 9 11 10 11 9 16
16 6 10 9 11 12 9 9 9 11 14 11 11 11 14 35 40
53 50 22 30 17 11 10 10 9 11 10 10 14 9 16 6 9
13 34 13 19 25 14 13 10 10 9 10 9 11 18 10 11 7
9 14 7 6 11 10 17 17 6 6 9 13 14 12 9 10 9
7 6 9 9 6 12 9 9 10 10 11 9 6 7 10 10 12
16 15 12 11 11 12 11 9 10 9 9 9 10 11 11 6 9
14 15 11 14 10 11 9 9 11 10 11 11 11 6 10 10 11
11 10 14 10 22 19 17 9 9 11 12 10 8 8 10 8 7
6 9 10 6 10 8 9 11 14 15 14 12 12 12 6 8 10
11 11 9 10 13 11 9 14 10 9 8 12 11 8 11 7 9
9 9 8 9 15 6 10 9 11 6 10 10 10 6 14 16 10
12 16 14 6 7 9 10 6 6 9 7 6 6 9 9 6 10
13 16 6 6 8 10 9 6 9 9 8 9 11 8 8 11 9
8 11 11 9 6 8 6 9 11 10 8 6 9 6 11 9 7
9 8 9 9 11 10 10 14 9 14 10 9 19 12 13 19 9
9 9 8 9 14 11 10 11 14 9 10 15 13 12 9 14 14
10 14 11 11 14 8 9 9 9 8 18 14 8 7 8 10 11
10 6 9 14 6 11 9 9 10 8 14 6 11 9 10 6 7
11 11 10 10 9 10 9 9 6 9 9 6 7 9 9 9 6
14 10 11 14 9 10 9 10 9 18 14 9 9 9 10 8 9
14 6 11 9 14 9 10 10 10 11 9 10 10 8 11 10 11
11 14 18 6