S03036-01_F02
Seqid S03036-01_F02
Sequence >S03036-01_F02.phd
NNNNNNNTTNTTNGGGNNNNNNNNTNNGNGGCGATTGGCGGCCANTCGGCCGAATTGGCA
CTCTTCATTCGATAGGGGCTCAAGTCACCAACTACAATAAATTACATTATACTATAACAT
GTCATCTGCTCTATACAAACAAAACACAAATTTTACTCATTCTACCGGTTCTTTCTTGCA
AAGCGCACCTGTTGAACTGACGACAGTCAGTGGGTACCAGGAGTTTTTGAAGAAGCAAGA
GAAAAAGAACTATGAAATTCAAACAGTTTTAAGCGAGGATAAATCACATGGTTATGTGCT
AAAGGACGGCGAAGTCATCGCTAATATCATTGGTGAGGCCAAAGATTATCTTTTGGATTT
GGCCGGCCAGGCTTGAACGAGTGGCTAAATATTTGTTCGATACGAGTCACTTCATGCACA
CTTTGATTTGCACTCTTATTGCTGGGCTGTAGTTTTCTTTTCCGTTTTCGCTTATAAATC
TAACATGTTCTATTAGGGGAAAGAAAGGCGCAAATTGTAGAGTTTGTTAGGTCTTTTAAG
TACTTGATTTCACCAACCGAAAGTGAAAGAAATAAAAAAAGATAAAGCTATTATTATTAC
CATGACCCTGTCATTGGTTTAAAACNTTTGTCCGTCTGCTTTTGATGGTTTTAAAAGANG
GTAAATACCTCCCCACACGTAGAGGTGTGTGGAGTGGGTGGGGAGAAATNNTATTTTTTT
TTATTTATNAAAAAAAANAAAAAANANATAAAAAGNGCGGGTGCCGGCCATAAGGGAAGA
GTGGGGATAAAAAAGTGAACCAAAAAAACAAGCCCCCCCCAGGGCCAAGGGGGAGAGTGA
GGGANGGGTTTGCCAANGCAATTGATT
Quality >S03036-01_F02.phd
5 3 3 3 2 5 7 24 22 4 18 11 3 12 25 15 3
5 7 6 7 5 7 7 8 5 5 9 6 22 24 17 17 14
15 31 40 25 18 44 29 17 9 9 7 40 42 46 29 40 42
41 31 21 31 48 48 32 32 27 28 51 52 50 50 32 19 50
51 52 51 43 37 50 50 49 49 42 35 49 51 32 36 46 38
49 46 34 35 42 49 49 42 38 50 42 47 47 49 49 49 50
50 49 50 34 50 42 59 59 54 53 43 50 57 57 51 50 42
51 53 46 50 50 57 51 53 53 53 57 53 42 46 57 54 57
32 57 57 52 50 57 53 53 57 54 57 52 53 53 53 53 53
50 50 53 53 53 44 59 57 57 52 57 57 57 57 57 57 57
49 51 53 57 54 57 57 53 50 43 57 53 51 50 57 54 54
50 53 53 51 53 53 53 45 51 47 57 57 45 50 50 51 49
44 57 54 54 54 54 52 50 63 63 49 42 42 63 44 60 63
45 42 49 63 63 43 63 63 42 42 46 47 63 42 54 50 63
60 63 35 63 63 63 43 43 49 63 43 47 49 42 49 49 58
63 63 42 63 42 27 43 43 44 28 50 60 63 63 58 42 42
41 47 49 49 35 41 24 18 42 63 63 60 42 42 44 42 60
44 63 42 63 44 39 47 42 47 42 47 35 63 63 42 63 44
19 42 43 26 42 63 63 21 54 44 35 44 60 60 46 46 35
59 44 43 34 50 44 44 59 59 59 34 59 50 30 50 26 59
30 59 54 50 47 22 57 50 44 59 54 53 57 57 49 53 44
29 59 59 54 45 28 53 49 57 31 59 43 44 53 54 59 59
42 49 51 50 54 54 42 59 54 51 42 54 34 59 57 50 54
34 57 57 54 32 59 59 31 54 31 46 42 44 59 46 59 44
44 46 43 57 42 27 54 54 43 50 46 59 59 54 54 54 43
43 29 59 59 50 44 54 50 59 59 54 54 59 30 57 54 30
54 35 57 57 42 54 42 22 32 25 46 57 57 57 42 28 49
50 54 26 54 32 22 50 49 54 34 31 42 44 54 34 27 25
49 37 27 33 41 31 54 34 30 35 46 22 49 43 32 54 25
54 30 17 54 54 54 37 54 49 30 47 54 49 18 54 21 35
54 22 59 54 32 57 32 19 38 27 43 23 22 50 49 32 19
35 35 14 49 30 46 32 54 49 46 21 42 36 35 27 35 21
54 33 27 23 29 57 30 17 41 36 14 35 35 28 17 25 46
49 18 27 19 22 28 54 22 35 31 35 20 19 35 35 49 43
43 43 38 28 22 20 35 30 24 17 17 17 19 35 28 23 28
22 28 38 30 35 38 22 38 32 22 14 18 19 18 19 22 23
18 27 35 27 24 19 28 38 11 35 36 17 11 7 12 22 43
41 23 23 23 18 16 28 22 30 22 15 19 19 20 15 20 14
14 14 23 30 19 14 10 15 14 15 11 9 7 22 14 11 29
19 19 14 17 14 12 12 10 14 17 8 10 10 10 10 10 11
11 9 12 17 14 9 16 11 12 14 11 16 11 14 15 15 9
9 10 9 9 13 11 11 8 10 14 24 11 7 7 13 11 25
21 17 21 23 14 14 9 11 19 11 11 11 13 14 6 19 23
23 22 35 24 23 35 6 30 28 34 22 36 36 6 28 6 8
10 13 14 19 12 13 11 7 10 10 10 13 11 10 14 11 11
13 32 16 11 20 22 26 17 32 35 19 28 14 15 21 13 13
14 28 15 15 23 11 16 13 35 29 14 11 11 12 29 10 10
13 11 10 11 36 36 26 17 14 10 12 13 11 25 13 21 10
9 9 10 11 11 10 10 10 11 10 8 9 14 15 15 15 17
8 14 13 11 10 17 23 32 11 11 11 7 11 11 26 14 10
13 9 9 8 8 9 7 10 9 14 13 9 9 11 10 10 9