S03036-01_F03
Seqid S03036-01_F03
Sequence >S03036-01_F03.phd
NNNNNNNNNNNNTGGTCAGGNNNNNAANANANGGNGATTGGCGGCNNATCGGCCGAATTG
GATGGATTCATCCGCTCGAGGAGCTAAAATGGGGAATGAATTCCTTCCAAATAGAAATAG
TACTTACTTCATTGTATTGTTGGAAAATATAAATCAATATTAACAATAAGAAAATTATTC
CATTATTGATTTATGAGATTAAAATCACACAGCCTACATACAACTCAATAACGTTATCTG
CCTTGCAAAACTGCCTCTGTATATATATCGATGATCTTCAAAATATACTATTTTAAGAAG
TGTTTTAATTGAAGGATTAAAGTACAGGGTAACTTTTTAAAATTCATTGTATTGCTAAAA
TAGTATTTTTCTTCTCAGATTCATAACAAAACATAATTTCTTCCACATTATGAGAGACAA
GTCGTCCAAACTCTTTCCNCCTAAAACCATGAAATAAATTCAACACCGACCCAGNNACCG
CTGCTCGGNCTAGGGTGNGCTGGATACTTTANAGGANTTTAAANTGANANAAAAAGGNAA
ACAGAAAAAGGGATGNGGACAAANAAGAAATAAAAANAANTAAACCCGNTCNNCCAANTA
GGGGGGGAGANCGGAGNNGNNNGAGNATTCTNGTACAAAAATTANTNATGGNGAGATGTA
AGNNNANATGNNNGNGGGGNTATGNAAGGCTTNAAGNGAANCCCACCACACNCNNGCCAC
CCGTGNNNANGGGGGAGGNNNNTTGGGGAGNTANGCAGNTTATNGTGAGGANNNGAGGNN
GNNGAGGCNNAAGAANNCTAAAAAAANNNNNAAGNNGCNNACGTCATGGTCNNNNGGNNC
NANNATCNGNGACCGCACGNNCACGACGTTGGGGN
Quality >S03036-01_F03.phd
6 5 5 5 3 3 4 3 3 3 4 5 8 8 8 9 10
10 10 9 5 5 5 6 7 9 8 7 9 6 8 5 12 10
6 24 16 15 19 25 11 9 13 15 12 5 5 9 31 28 30
25 21 24 20 25 11 24 19 15 9 10 16 35 32 20 9 19
26 11 29 27 26 26 26 24 28 17 28 28 46 21 15 32 25
14 13 9 11 16 36 31 36 28 21 22 20 22 15 12 18 27
35 30 30 28 26 20 11 10 14 15 15 24 21 19 24 30 27
37 33 35 33 28 26 26 35 42 39 30 29 42 53 49 45 39
43 46 45 28 42 49 42 33 35 39 35 42 54 50 43 43 50
50 42 54 54 52 54 50 39 49 49 42 31 35 32 35 35 35
40 35 35 35 43 52 37 42 40 35 32 31 29 44 37 43 40
49 43 42 54 50 35 47 53 57 57 57 27 47 54 50 54 49
51 49 38 59 35 46 35 37 37 40 29 37 46 32 46 35 31
15 35 46 46 43 26 36 32 28 28 32 35 26 19 17 26 23
26 29 12 12 14 18 32 17 17 20 31 32 36 49 49 46 40
43 29 43 30 50 23 42 33 46 37 54 35 46 40 43 46 42
49 42 25 49 39 49 43 22 42 49 49 42 42 42 35 54 43
54 42 50 43 31 37 38 46 42 38 40 35 42 21 46 31 23
28 42 46 45 35 27 31 35 49 32 19 46 28 42 42 35 39
33 35 42 36 44 29 25 38 38 42 39 39 32 33 32 26 28
32 23 26 19 23 13 26 26 32 15 16 27 42 29 20 26 15
18 14 14 16 21 39 16 35 16 27 21 17 39 44 33 60 42
29 35 49 31 33 27 33 28 29 42 28 26 28 22 16 29 21
27 22 21 22 34 46 58 52 40 22 40 35 43 34 32 29 35
42 42 33 47 18 8 9 18 41 17 14 20 22 24 41 32 28
30 30 18 26 22 18 24 23 26 29 30 18 9 6 10 12 30
35 21 35 29 15 15 18 13 11 16 16 13 13 13 44 25 13
18 17 11 11 8 9 8 11 19 16 8 9 9 9 8 6 6
8 12 16 22 9 9 18 12 11 18 11 10 7 10 9 16 15
9 9 11 13 6 9 11 10 8 8 11 17 9 14 32 16 10
14 6 11 9 10 9 6 11 8 18 12 11 11 6 9 14 11
6 11 7 11 12 20 20 15 16 9 6 18 12 9 9 11 13
24 8 12 14 10 16 24 12 11 9 16 6 9 23 9 9 11
16 12 6 9 16 18 11 9 14 10 12 23 17 9 10 6 9
14 7 9 12 20 14 9 9 11 10 6 10 9 6 6 12 9
11 9 7 8 11 11 9 22 10 11 23 22 8 13 11 6 9
23 16 17 14 6 6 8 6 6 6 13 9 9 6 14 12 14
8 11 6 9 8 11 8 10 11 10 8 11 10 10 9 6 8
6 12 10 11 11 6 10 13 13 22 9 11 11 12 9 9 7
7 6 9 6 9 9 9 6 6 6 10 6 12 19 14 12 6
12 18 9 10 6 14 20 9 12 8 11 9 6 11 18 10 6
8 8 9 6 11 11 8 23 9 9 11 11 9 9 7 8 7
6 19 14 12 14 11 9 10 10 11 14 5 6 7 9 6 12
14 19 9 10 11 12 13 5 6 7 5 10 8 14 9 10 13
22 18 6 10 11 6 16 8 8 8 7 10 9 10 13 6 9
11 9 10 10 8 11 6 6 6 9 19 9 10 5 5 15 5
6 9 8 9 10 11 7 5 9 10 11 8 14 5 5 9 10
9 11 10 12 9 9 14 6 6 5 5 7 8 8 11 5 5
9 10 5 5 9 17 11 8 8 11 9 15 8 10 14 6 5
5 5 10 13 6 5 9 5 9 6 7 11 8 10 6 11 6
22 9 9 11 8 11 10 8 10 5 5 9 10 8 9 11 10
9 9 8 10 10 10 10 5