S03036-01_F04
Seqid S03036-01_F04
Sequence >S03036-01_F04.phd
NNNNNNNNNNNTNCNNGCNNNANNNATAAGGNGATTGGNGGCCAAATCGGCCGAATTGAT
AGAATAAAAAACCAAGGATAACAAACATCTTCTTTCGTTCGCTTCAAAATAACTACAAAT
TAAAAATGCAATTCTCTACCGTCGCTTCTATCGCTGCTATTGCCGCTGTTGCCTCCGCCG
CTTCTAACATTACCACTGCTACTGTCACAGAAGAATCTACCACTTTGGTCACTATCACTT
CCTGTGAGGACCACGTTTGTTCTGAAACAGTTTCCCCAGCTTTGGTTTCCACTGCTACCG
TCACCGTAAATGACGTTATCACTCAATACACCACCTGGTGTCCATTGCCAACCACTGAAG
CACCAAAGAATACCACTTCTCCAGCTCCAACTGAAAAGCCAACCGAAAAGCCAACTGAAA
AGCCAACTGAAAAGCCAACCCAACAAGGTTCTAGCACTCAAACTGTTACCTCCTACACTG
GTGCCGCTGTTAAGGCTTTGCCAGCTGCCGGTGCTTTGTTGGCTGGTGCTGCCGCTTTAT
TGTTGTAATTTACTCAACCTTTTCTTTAATATATTTTTAGAAAAATGGTTAAGTACTTTT
CCGTCAATACAGCTTCCACAAAATCCTTTTATTTCAATTAATAAGATATTCTGGTAATTT
CTTATTCTAATTCTAGGAGGCAACACTCCATAACTAAATGTTTATTATAATAATATTAAT
ATAAAGTTAATATCTCNTANGTTACACGCAACTNAACTTTTATTANNNATACTGGTTGCA
NTGTATTTTTATCATANNNNNNAATATAAGGTTGTTTAAGGGTNNNTAAATCANAGNANN
GGTTTGNGGACGCANCCANAAACAAATCCAGGGGGGGGGGNGGANNGGGAGTAAGAGNAA
GAANTNTGNNCN
Quality >S03036-01_F04.phd
5 2 3 3 3 3 3 4 2 5 3 8 6 8 5 7 10
10 5 5 3 9 6 5 3 8 8 14 8 8 10 5 19 25
27 26 24 8 7 15 21 14 25 8 19 31 41 35 41 25 33
43 42 32 27 36 46 34 14 18 28 31 34 37 18 40 37 42
38 38 37 25 30 28 45 38 46 20 16 49 50 42 31 46 49
31 21 32 35 35 49 52 46 49 41 39 35 32 29 41 31 41
59 42 42 26 30 37 36 35 36 32 40 42 42 43 33 50 50
50 43 50 43 43 50 50 42 54 59 54 49 50 53 53 53 51
57 54 51 49 49 49 49 54 51 54 51 49 42 50 59 57 54
50 53 53 53 42 50 51 51 53 50 53 50 50 50 51 54 54
57 47 53 51 57 57 54 57 51 57 57 53 53 45 42 46 57
54 54 57 57 54 52 50 50 53 53 53 53 42 50 50 53 57
57 51 50 50 49 50 53 51 49 53 46 50 57 50 57 49 53
42 54 57 53 47 51 50 49 49 46 42 50 54 49 46 50 49
46 49 49 43 46 49 49 45 45 28 57 38 32 46 46 49 50
50 53 53 49 50 57 50 49 51 51 51 51 54 44 49 51 53
53 46 53 53 53 50 54 54 57 53 53 49 53 42 57 51 46
49 39 50 49 49 49 50 59 54 53 49 54 54 35 50 53 49
49 50 51 51 43 53 47 32 50 49 47 46 49 50 42 50 49
50 33 53 49 49 49 42 49 53 42 54 59 50 50 51 42 49
35 49 46 33 45 46 42 39 42 19 46 40 51 43 51 49 50
50 49 46 50 49 32 50 33 49 51 46 50 49 35 54 43 50
50 51 53 57 54 57 54 51 35 49 51 57 35 51 32 49 49
53 54 57 57 57 57 54 49 57 32 57 43 57 54 54 57 57
57 36 32 57 30 53 35 54 49 39 43 47 51 46 41 57 35
53 37 49 49 39 53 53 53 35 32 51 30 51 35 51 49 35
42 42 32 59 43 57 32 53 35 54 54 37 49 37 35 46 32
30 57 57 35 54 54 30 54 35 32 51 32 35 53 32 43 35
25 36 35 40 34 35 59 35 44 31 31 49 46 35 49 29 43
20 43 24 39 43 46 32 32 46 31 38 46 50 46 36 43 36
49 46 35 46 35 47 51 37 33 50 30 46 29 49 46 49 33
35 31 37 46 35 39 26 41 43 50 49 47 26 51 42 18 50
50 33 46 50 35 46 46 35 31 37 35 19 50 35 51 35 51
51 47 29 18 51 46 17 42 46 35 40 37 29 49 49 49 46
42 31 31 42 31 45 49 25 41 42 16 41 30 43 27 43 35
43 28 41 21 25 24 23 19 29 32 13 23 34 34 40 16 19
23 20 20 25 45 32 30 13 13 20 20 28 22 17 22 32 35
36 31 18 18 26 31 14 15 14 17 15 28 37 46 49 30 35
15 26 27 26 26 35 40 49 31 30 27 17 20 19 23 13 33
31 15 30 41 26 15 18 26 46 36 27 31 26 41 21 10 18
11 26 37 43 32 30 40 28 49 21 20 13 15 26 29 29 39
40 28 31 14 13 19 17 26 30 28 35 35 43 27 18 30 35
36 26 25 32 29 18 30 32 21 34 13 9 14 23 12 13 12
26 17 17 8 11 6 12 11 5 10 8 19 19 23 15 22 26
24 19 26 14 9 6 12 28 12 9 9 18 18 28 13 9 12
7 7 7 11 10 10 17 10 21 37 15 15 21 20 12 6 8
8 27 26 12 14 14 12 12 17 31 11 10 9 20 7 6 7
6 7 7 22 16 21 30 16 18 16 16 27 21 17 20 14 13
13 12 19 8 14 11 16 6 6 7 9 9 9 14 21 19 9
7 9 8 6 9 7 7 9 12 11 22 13 8 7 10 8 10
10 12 10 8 7 9 9 14 7 10 8 13 11 14 11 16 9
9 13 16 10 8 14 10 12 13 14 11 11 11 6 11 9 8
6 7 11 10 9 11 17 10 12 12 15 15 24 6 9 11 11
24 9 7 9 6 9 10 6 6 12 7