S03036-01_F10
Seqid S03036-01_F10
Sequence >S03036-01_F10.phd
GNNNNNNNNNTTTNCCAANNNCCANANNNANNAGGNGATTGNCGGCCAATCGGCCGAATT
TGAAGATAAACCTGCCGATAAATCATATTTCAGAACGCTAATCAATTCATCATGCTAAGC
AGGATCCAAAATTATACCAGTGGGTTGGTTTCTAAAGCAAATCTTTTGTCATCAAAGGCT
TTATACTATGGTAAAGTCGGTGCCGAGATTTCAAAACAGATTTATTTAAAAGAGGGTCTT
CNACCACCAACTGTTGCCCAGTTCAAATCAGTGTATTCGAACCTTTATAAGCAGAGCCTA
AACTTTGCTCTAAAGCCTACAGAAGTTTTATCGTGTTTAAAAAACATCCAAAAGAATGAA
CTATTAAAATATGGCGCATATGGTATTCAGTTGATAGGGTTTTATTCTGTCGGTGAAATA
ATTGGAAGAAGAAAATTAGTGGGATATAAACATCACTAAGCTTTTTAATTCTATNTATTC
NTAAAACGNTTGGAGGTNCGGGTGATGGAAATTTNGTTTTTTGTACATATAGAACAAAAC
AAAAAAAAAGGAGGAGAGTTCCATCNCAATTCTATTTATTTTGTTNAATGAAAAAAAGAN
NGCAATCCCCCTCTCTCTCGGGAGGAGGGNGGGGGGGAGGGGGGGGTGTTTTTATTATAT
TTTAAAAAAAAAAAAAAAGAAGAGGNCCCCNCCCACTATCNTCATGGGGTGATCAAAAAA
AAAAGAAAAAAAAAAACCCTCCCCTCACTCCCCCCCGCGCGAGAGGGGGAGAAGGGGGTG
GGGGANNGNGTANAATNANATAAAAAAAAAAAAGAGGCAAANNGCGCCGCGNATTTTCTT
GTCAACGCAAGAGNAAATANAGAAAAAAAAAAAATATAATTTTTNANTGTATCTTTGTGG
CGAGAGAGGAGAGTGGTATGGATGATGTTTTTTTTTTTTTATTTCAAAAAAAAAGCAN
Quality >S03036-01_F10.phd
10 5 5 4 7 6 4 3 4 3 9 15 10 7 9 10 14
10 6 7 6 12 10 10 6 9 5 5 5 8 5 5 9 16
11 6 12 15 20 20 20 7 14 13 16 10 9 9 9 18 18
26 26 21 18 17 23 12 25 39 26 15 20 16 20 29 14 20
25 28 32 31 35 36 30 29 32 42 21 33 40 35 33 31 34
33 35 30 36 28 28 32 36 54 42 44 39 36 28 19 24 27
35 35 44 44 44 32 22 33 35 18 27 47 28 23 22 31 44
33 33 35 60 46 39 44 38 35 60 57 52 52 58 60 60 39
46 46 38 42 52 52 60 52 57 52 52 46 52 60 52 52 52
57 49 49 50 60 49 63 42 42 35 35 60 60 60 50 42 47
42 60 47 42 47 60 50 50 47 60 63 47 42 60 60 47 44
50 60 50 47 49 49 60 54 60 49 47 60 42 43 60 54 60
49 58 45 45 44 49 46 36 36 39 43 42 43 44 39 44 44
60 47 47 47 60 44 42 40 35 60 47 54 50 60 63 35 35
33 19 16 7 11 26 22 22 32 17 28 44 42 47 54 60 46
49 49 60 50 47 47 54 54 47 44 40 38 60 50 50 47 60
58 47 60 47 47 49 47 63 60 46 60 49 60 50 58 49 49
49 58 60 54 60 58 60 47 60 47 50 47 60 60 54 60 60
49 47 49 60 50 60 47 60 47 42 43 47 50 60 47 60 60
43 49 60 60 60 49 49 47 49 50 50 63 57 60 57 60 57
60 60 60 52 52 46 60 57 57 29 40 33 40 34 57 40 35
60 44 46 40 27 36 21 18 23 22 29 22 23 33 35 63 52
35 52 60 47 46 47 47 57 53 52 60 48 47 42 42 35 60
48 35 42 39 41 29 40 33 42 57 57 52 60 52 60 60 33
43 47 46 46 46 37 57 57 57 46 35 41 35 41 47 46 46
41 39 46 60 42 46 46 38 32 32 42 37 37 25 37 45 47
46 46 46 46 46 35 22 33 53 46 42 28 46 46 47 53 33
18 28 18 22 28 31 41 29 46 31 41 27 28 28 11 6 11
27 18 19 19 6 8 10 19 19 15 9 8 6 9 22 53 19
19 11 9 9 6 11 12 35 14 13 9 14 11 10 9 10 22
22 21 22 13 6 9 8 22 16 15 14 22 17 12 9 15 8
8 11 16 46 11 12 19 23 11 22 40 46 14 11 13 14 14
27 32 32 34 14 17 16 15 11 9 11 12 13 10 12 10 10
14 22 32 18 7 10 10 22 46 32 14 14 16 16 24 12 10
12 18 26 13 12 12 14 6 10 18 14 21 17 24 17 24 47
12 11 9 11 6 6 8 10 10 9 10 10 14 15 14 17 13
16 11 17 11 13 11 14 14 9 13 13 14 14 21 23 32 24
7 29 40 27 32 19 19 11 9 13 15 14 11 10 13 9 10
9 10 14 17 40 40 53 16 18 18 10 16 12 15 23 14 20
19 10 11 33 14 26 34 28 46 33 27 26 26 13 31 11 10
27 11 14 10 22 7 9 11 18 13 6 11 9 10 15 10 9
9 16 9 7 12 11 13 10 10 14 13 18 8 16 13 12 11
9 18 24 23 18 10 31 27 16 9 13 24 32 14 32 32 32
53 46 32 10 9 13 9 9 11 12 15 14 14 15 19 19 20
14 16 32 26 17 20 17 14 14 10 10 9 9 11 32 14 22
23 16 34 26 20 27 13 14 32 32 14 22 17 12 12 32 16
17 10 10 6 7 8 6 8 9 9 5 9 9 10 6 8 6
9 17 10 9 11 18 26 23 35 26 34 25 25 9 11 20 11
16 14 12 11 20 6 7 10 8 11 16 20 27 17 9 7 13
9 13 14 17 18 15 16 16 14 14 12 19 17 16 19 13 17
13 15 14 7 14 14 8 13 24 6 40 10 11 18 12 14 34
34 47 35 35 35 23 19 11 17 17 12 12 19 18 12 12 14
7 11 6 10 12 10 11 13 9 9 9 9 9 9 11 16 13
18 11 19 10 38 15 26 29 16 15 20 28 11 13 9 10 13
10 19 12 11 8 13 11 10 11 33 23 18 14 22 14 35 25
46 18 17 25 10 9 10 15 9 12 10 10 15 35 10 14 14
11 9 10 9 11 6