S03036-01_F12
Seqid S03036-01_F12
Sequence >S03036-01_F12.phd
NNNNTNNNNNNNNNNNNGGNACNNNNNNNNGGNGATTGGCGGCCAAATCGGCCGAATTTG
GGACAATACTTTAAAAAAAGAAAAATATAGAAAAATGAGACCAGCACAGTTACTGTTGAA
TACAGCTAAAAAAACATCTGGTGGCTACAAAATACCCGTCGAATTAACACCGTTATTTCT
CGCTGTTGGTGTAGCTTTATGCTCTGGGACATACTTCACATATAAGAAATTAAGAACCGA
CGAGACTTTGAGATTGACAGGTAACCCAGAATTATCTAGTTTAGATGAAGTCCTTGCCAA
AGATAAGGATTAAAAACCATGTTGATGATTTGTTATATTAATATCTACACTTAAAACATT
TTCAATAATTGTCGGGAACAAATCGAAATATTATTTATTCTTCAAATATGACAGAACTAA
TGTATATTATATACATGTCAACACCACCATGACTATATGTTTAATTGATGTATAATCATT
CCGNAAAAAGGNNAAAAAAAAAAAAAAAAAAAAAAATATNAATAAAAAAACTTACCGGCC
ATAAGGGCCAGCTTGAGTATTCTATAGTGTCACCTAAATAGCTGAGCGAAATCATAGNCA
TACCNCCNTTCCTGNGNGAAANTGGTNTNNGGTAAAATTTTCATATATCTTTCTANCCCG
AAAGCAAAANTGNAAAGCCGGGGGTGCCCGNTNNTTGTGNTAAATTAAATATAAATAAAT
AAAAACAAAATANNNNNNNTTNNNNGNGGGGGAGGNGTNGGGGAGGGGTGGANNNNANAN
TNNNNNNTAATANCCCNAAAAAAATAGNNNGGAGANTNGGCGTCTCTTCNNNNATCTCTA
ATAATAAAGANAAAATACAACAAAAANCNCTCTCCCCGCCANCGACAGGNGCGCGAGGGN
GGAGAGGNAAGNNNNNNNNTNNTNTANANCTGTATTAAAAACGANNNA
Quality >S03036-01_F12.phd
7 5 5 5 10 5 4 5 3 2 3 6 5 5 5 5 5
11 11 6 9 8 5 7 5 5 5 5 7 5 10 12 6 21
28 17 21 20 10 10 19 25 10 11 9 9 11 29 23 20 19
23 25 22 24 10 31 31 26 18 17 20 15 9 21 29 19 23
30 46 46 31 34 46 43 46 42 37 46 28 32 28 30 31 28
22 19 27 18 17 38 35 32 35 32 38 34 22 12 21 27 38
21 35 32 30 44 30 36 36 21 18 28 22 43 35 36 38 32
39 42 44 44 32 42 42 44 47 50 44 60 44 42 44 44 44
44 44 60 60 52 60 57 52 52 52 52 57 44 57 60 52 60
57 52 57 60 57 54 60 52 52 60 52 52 42 42 52 44 47
52 52 57 52 57 52 60 57 46 42 42 42 41 52 52 58 47
52 35 46 57 57 48 42 52 60 60 52 60 52 52 52 58 57
57 52 57 57 48 52 46 52 47 52 47 47 52 52 46 35 46
41 46 46 42 41 52 42 52 46 47 46 42 47 46 37 35 35
47 37 29 30 35 35 35 52 60 60 57 52 63 57 52 48 57
57 46 46 46 47 48 43 60 47 47 60 40 46 46 52 52 52
52 60 52 60 48 57 60 60 43 43 63 57 58 52 57 57 52
52 60 52 57 57 57 60 57 52 47 60 57 52 52 52 46 60
46 57 52 48 48 60 60 57 60 52 52 48 48 57 63 60 57
58 48 52 63 53 52 60 60 63 52 58 60 60 60 48 52 52
52 42 47 35 40 42 42 57 35 52 60 43 40 60 47 47 43
42 52 60 47 30 29 24 30 20 30 29 32 43 57 47 60 57
57 60 60 52 60 52 43 48 48 43 35 42 60 39 48 40 48
53 43 48 60 52 60 52 57 60 48 48 48 40 48 48 60 57
52 40 48 60 53 47 57 43 43 43 39 41 34 57 47 46 47
46 52 52 60 57 57 57 42 60 35 60 60 60 52 60 52 57
57 52 52 57 52 47 42 60 52 52 52 52 57 60 57 57 52
57 43 35 40 43 42 60 40 47 42 40 47 29 34 27 24 29
35 22 19 24 40 32 9 6 9 8 9 9 9 15 11 7 7
9 15 12 11 12 9 10 12 9 9 12 19 19 24 24 24 24
12 12 19 10 9 10 10 10 9 7 10 10 10 13 16 21 15
24 16 19 8 8 16 24 36 30 42 42 43 19 14 22 27 35
44 60 28 27 28 14 18 21 25 27 27 14 22 36 22 44 44
26 44 20 39 27 21 23 21 16 31 22 44 35 27 30 46 50
31 36 22 19 15 9 9 27 18 10 9 35 18 10 9 12 9
8 10 7 12 9 18 24 12 18 7 10 10 7 17 16 29 22
25 35 7 10 6 15 9 10 9 6 8 15 11 10 6 9 6
6 12 12 10 11 12 9 11 19 29 16 11 10 13 9 12 15
9 21 8 30 27 16 10 20 18 7 21 19 9 21 12 25 12
14 11 13 12 32 17 7 23 18 6 9 12 13 11 19 15 16
23 22 16 21 14 14 14 18 17 10 7 11 7 7 16 23 17
14 10 6 15 9 13 14 10 12 18 18 16 14 14 18 28 26
16 12 18 17 35 9 9 14 19 32 29 10 12 12 9 9 11
9 7 7 6 6 6 6 6 10 9 6 5 7 7 15 6 13
21 8 10 9 9 9 10 7 12 10 7 12 15 12 16 8 9
12 12 10 16 18 9 9 5 6 7 7 14 7 9 5 9 5
6 6 6 6 6 9 10 9 10 12 6 9 9 8 6 15 14
22 16 35 15 16 10 10 8 6 5 5 11 16 13 15 12 6
9 5 9 8 14 13 12 10 10 11 15 16 11 7 7 7 7
10 10 8 14 16 10 11 14 14 16 20 27 15 18 17 11 21
5 12 10 9 16 14 15 12 17 11 10 13 15 18 17 16 7
12 6 10 12 15 8 16 34 16 14 9 15 13 11 6 8 12
8 8 12 9 11 7 13 13 16 11 26 11 25 34 12 6 19
10 9 20 13 15 13 7 9 9 9 6 6 6 7 6 6 5
3 15 5 6 12 6 18 9 6 9 7 9 28 10 14 9 9
10 14 12 10 16 10 10 21 11 7 7 7 10