S03036-01_F13
Seqid S03036-01_F13
Sequence >S03036-01_F13.phd
NNNNNNNNNNNNNNNNNNGGNNNNNNCNANNNGGCGATTGGCGGCCNATCGGCCGAATTG
ACCGGAGAAACTCACTGAGAAACGTTGGAATAGAACAGTAGTAATCGCAGGACGGAATGT
CACTATTTGTAAGGCTCTGCCAGCCTCAATCAAGAAGAATGTTTTCATCTATATCTTCTT
TCTCTGCTCTATCTGTGTTACGCCCACAAACCGGTATGCTCTTAAACAGTTCACCATTGA
AGACCCCGTCCTTCACACCGTTGGGATTTGGCTTAATAGGTCAAAGAAGATGGAAATCAA
GGGGTAACACCTATCAACCTAGTACATTGAAACGGAAGAGAACTTTTGGTTTCTTGGCTA
GGGCCAAGAGCAAACAGGGCTCTAAGATATTGAAAAGGAGGAAGCTCAAAGGTAGGTGGT
TTTTGTCTCATTGAAATTTCACATACTATTGAGATAAATTTGAATACTTCTTGTACATAG
GTATCTAATGATTATGGAACATACACTTTCACTATTTTNTTTNNTTTTTTTTTAAAAGAA
AAATAGAAAGAAGAGAGGAGAGNAAGCNTAAANAAAGTACCGGCCATAAGGGGGCGAGGA
GAGGTATACCATACTGTCCCCCCACATCAGGGGGGGGGAGGAGGGGGAAAGCGTGTTTCT
GTTTAAAATTGTTTNCCACTACACATTCAGCCCGGCAGGANACCCCGAAACGTAAAAGTT
TAAATCATGGGTATGTTTTATTATAAAACTGCGACCAGAGAGGGAGGGGGGGGGGTGGGG
TTTTTTTTATTTTTNAATCATTTAGAGAANNAGCGNAAAAGCACCCCCCCCTATTTGGGG
AAGGCGAAACGCATTNTGAGTTTTTTTTATCATCCTACCACCATGGGGGGGCGGGGGGGG
GGAGGGGGTTTTTATGANTTTTGTAATTGANTAACACATCGAA
Quality >S03036-01_F13.phd
7 2 2 3 2 2 4 2 3 2 3 6 3 3 3 5 7
7 8 12 6 5 7 3 7 3 9 5 8 6 5 5 8 12
9 18 20 15 26 22 11 15 34 21 13 10 7 9 28 31 31
25 38 26 26 18 17 31 29 21 15 16 18 23 30 24 16 26
30 15 31 37 34 32 30 35 35 26 21 26 18 34 26 36 31
41 27 26 13 19 31 43 28 42 49 36 18 18 22 19 16 26
24 37 42 43 30 46 42 34 42 26 29 30 38 25 26 32 43
35 27 22 19 21 21 20 17 29 42 27 22 28 46 44 36 42
44 50 60 50 42 31 49 60 50 50 50 60 47 54 50 49 49
60 50 49 47 58 49 33 58 50 60 60 57 58 28 60 58 45
50 50 50 60 60 63 63 51 60 60 50 50 51 50 49 60 51
63 47 50 49 49 58 63 63 58 63 63 43 49 44 50 58 63
58 60 60 44 49 47 49 60 47 47 47 60 49 49 42 47 50
60 44 47 43 38 47 39 40 32 34 42 35 47 50 44 47 44
47 28 24 40 44 24 38 60 43 43 44 60 49 60 49 49 42
60 44 50 50 60 60 63 47 58 45 44 35 63 63 49 51 49
60 47 42 63 47 49 42 63 60 50 47 63 63 60 50 53 39
49 27 57 57 50 57 51 50 54 34 59 59 59 57 51 42 50
54 54 42 44 54 50 54 54 54 44 59 50 59 54 54 42 44
49 42 39 43 53 49 54 57 49 50 54 57 46 51 39 57 13
54 54 39 50 54 54 49 46 49 36 50 46 50 36 46 46 42
39 50 42 43 50 47 31 54 22 54 39 49 39 59 34 54 54
50 46 49 51 49 43 57 50 50 42 54 42 50 34 44 44 53
42 35 44 50 54 42 49 50 19 49 54 54 36 49 50 36 22
51 49 42 50 27 50 36 50 36 54 54 31 50 46 50 54 50
43 42 42 31 19 27 29 31 34 43 42 49 51 49 28 22 39
50 59 44 50 50 54 31 32 42 42 44 50 26 39 50 50 26
42 44 23 27 22 27 21 22 20 22 28 26 44 42 31 13 31
9 14 11 8 24 35 21 28 23 22 15 35 33 20 12 10 19
28 14 15 11 9 16 13 14 11 13 14 15 19 24 19 15 10
11 15 35 44 35 60 25 8 6 9 10 11 7 7 14 14 23
14 14 14 14 13 14 14 20 9 11 15 17 14 35 14 12 10
13 10 15 15 15 10 11 11 9 10 24 17 14 15 14 16 9
9 7 10 11 10 9 6 9 12 8 14 7 13 15 11 12 25
16 18 16 22 29 15 19 19 16 19 22 18 19 46 20 13 14
10 28 19 9 10 10 11 11 11 23 16 13 12 11 10 11 9
10 9 14 12 12 18 24 24 24 27 15 14 12 12 10 11 8
11 14 15 32 35 23 12 10 9 13 16 12 11 22 14 27 20
10 12 11 10 10 11 18 14 14 23 40 28 16 13 10 10 11
16 18 21 22 11 22 26 15 19 24 9 7 13 11 12 13 14
8 10 13 12 14 11 15 12 12 11 15 18 9 9 11 14 11
16 17 14 7 16 11 24 15 23 13 22 19 13 11 11 11 10
13 10 14 11 10 8 11 13 15 16 13 11 14 11 19 11 8
14 9 9 9 11 16 19 11 11 8 8 11 10 11 13 12 13
9 10 12 14 13 11 9 13 11 9 11 11 11 9 9 14 9
15 13 11 22 28 14 14 13 10 12 11 22 27 12 10 19 9
10 15 15 19 20 28 10 22 19 13 9 8 6 13 13 9 9
17 20 20 13 12 10 10 13 18 11 7 7 10 15 10 11 6
11 10 11 11 10 11 16 9 11 8 10 10 9 9 8 10 10
12 16 27 23 17 19 22 20 15 11 10 9 11 9 10 11 9
10 11 11 9 10 7 16 11 11 14 10 9 12 10 18 17 27
20 11 10 11 16 19 11 14 9 13 14 16 19 17 14 16 10
9 10 10 8 21 16 14 14 23 28 28 15 22 15 11 13 11
14 11 10 14 22 10 11 10 14 14 14 14 16 10 14 9 6
14 10 9 9 11 8 16 22 13 20 19 18 6 9 8 10 11
11 11 12 11 11 10 15 16