S03036-01_F14
Seqid S03036-01_F14
Sequence >S03036-01_F14.phd
CNTNNNNNNTTNTTTTAGNCCAAAAAAAAAANNNGAGCCANNGGGGNNTCGGCCGANTTG
ANGTCGTAATGGAGTTGGAGCATTCGTGTTTCCATGCAGAAAGATTACTTTGCAATTCTG
TAACTGGGGAGGGTCTTCGGAAGGCATGAGGAAATTTTTGACTTCAAAGAGATTAGATAA
ATGGGGCCAGGAGTTCCCATGGATACAGTTTGAAGTGATGAGGAAGTCTGGACATCCTTT
GTTGAGGGCAGAATACACAAATGGGCGTGAAAAAGTTATTTGTGTGAGAAACTTGAACAT
TGACAATGTAGAAAACAAGCTAAAGCTATTGAAGGATTCTGATGGAGACATTTTACGCAG
AAGANCAAAGAATGATANTGTGGATAGCTTGAACAGTAGTGTGAGGGGTATATGGACNCC
TCTGCACGNTGCGAATATGNATAGNATTTTACTTAAANANAAAAAAAAACCNCCCCCAAC
CCCCCCCCCTCCNAATGNGGGGAGAGGGGNGTTTNNTTTTTTTTTTTTTTTTAAAANAAA
AGAAAAANGAANGNAGGGGGCGGGGAGGTACCTGGTCGTAGAAGAAAANAAAAAAAACCC
CCAACCNCCCCCCCCACCCCGGNGNGGGANAGGGGGGGAGTANNNATTATTTAATTATTT
AAATAAAAAGAAANTGAAAATNAAAGATNNNAGAGTCAATGGAGTGNNNNATCTAGNAAA
AACCACACANTCANAACCACCGGGCGGGGNGGGANTGGAAGGGGGTAGTGAAATTTAAAT
AAANAAAANCNNAAGANNNTANNGAAAAAACTAAGAGNGGCCNTNNNCGAAGNCTCGAGG
AAAGAACAAAACNNCAANCNNCANGCNNGNAGGCCGCTAAGCGGGAGTTTNGNNNTTGNG
AAGGNTAACATTAATNTAACAANNGTAAAA
Quality >S03036-01_F14.phd
10 7 8 5 6 3 3 7 7 10 9 5 9 12 9 9 11
10 5 11 11 9 9 12 11 10 8 14 16 13 10 5 7 6
12 15 13 12 10 9 5 6 10 12 9 10 6 6 15 13 15
15 16 15 13 17 6 20 16 10 9 6 12 18 21 19 21 33
27 23 24 9 21 14 35 29 31 32 42 20 35 34 32 42 32
11 13 22 19 28 24 42 30 18 36 30 21 9 9 18 11 10
22 32 32 33 46 46 41 47 41 42 34 23 23 21 45 45 53
53 53 38 38 33 45 53 53 53 38 46 42 53 37 53 57 53
53 57 53 53 52 53 53 52 53 53 53 53 52 53 60 52 60
37 37 53 60 60 53 52 53 52 60 57 52 53 53 57 60 53
53 37 37 53 52 42 52 60 42 47 38 53 57 60 60 53 53
52 45 53 53 40 40 53 53 53 53 53 53 53 53 53 41 53
53 53 53 60 57 53 53 53 53 53 41 47 53 37 33 42 53
27 42 42 36 18 38 37 34 38 53 53 53 45 45 42 40 40
32 27 45 24 28 29 42 53 53 53 53 45 42 60 53 60 53
53 53 53 46 35 33 45 57 45 41 53 47 53 44 43 53 53
53 53 53 53 39 35 53 53 53 41 37 43 28 53 52 57 53
43 60 52 60 53 60 53 53 57 32 53 53 44 37 53 42 53
53 60 53 38 18 30 28 27 53 53 25 35 44 53 53 53 53
41 37 43 53 60 42 53 53 53 43 23 43 48 11 43 53 32
27 35 23 27 18 27 13 17 23 13 19 18 16 16 9 12 8
13 18 28 39 11 11 19 6 15 25 20 25 18 25 27 24 45
38 23 13 6 19 53 30 35 31 13 8 13 28 32 30 27 25
19 19 20 12 8 15 23 8 15 27 39 11 35 9 18 19 35
17 32 9 14 9 25 20 19 14 6 8 14 16 17 14 23 28
9 9 11 6 11 12 12 9 13 11 11 13 11 25 6 9 8
9 10 6 9 12 19 22 16 12 14 24 19 11 16 11 7 16
7 19 11 42 42 14 10 12 9 11 10 11 6 10 9 10 14
10 9 9 9 14 11 11 12 14 18 28 19 13 9 11 23 7
9 11 9 8 6 10 8 9 13 9 10 8 13 9 9 9 6
11 16 29 23 6 7 19 12 14 41 10 11 8 11 9 13 13
9 13 9 9 11 18 11 9 14 7 14 28 23 22 9 30 14
11 17 10 6 9 16 10 6 8 6 9 11 14 12 11 18 11
23 14 10 11 9 9 14 17 23 9 14 9 9 11 9 9 11
9 19 10 14 8 8 13 20 11 9 6 9 9 40 10 9 18
27 11 8 10 8 12 11 11 9 9 12 6 12 8 11 10 9
9 14 9 8 14 14 10 11 19 20 6 10 6 9 16 14 10
6 9 9 13 14 20 26 24 13 10 14 16 12 6 6 6 9
9 12 10 11 9 12 11 11 10 9 9 14 11 11 10 9 16
8 23 23 32 16 19 9 14 17 10 6 9 11 11 23 10 11
9 6 18 14 11 9 13 9 6 6 6 9 8 12 11 11 10
11 26 9 11 9 9 16 9 9 6 6 6 6 10 11 9 10
9 11 6 22 14 11 13 11 9 15 9 11 9 10 11 6 8
10 11 7 11 11 14 19 10 9 9 9 10 12 11 24 14 14
12 7 14 27 9 9 6 9 8 14 11 8 11 14 12 11 19
9 9 8 8 9 10 10 10 17 24 9 12 10 11 10 12 10
8 7 9 34 9 10 6 9 6 6 27 16 9 28 7 6 7
9 11 6 6 9 8 11 11 9 9 14 11 10 14 10 11 13
9 6 8 14 8 9 6 10 6 6 6 9 11 11 9 11 6
11 13 9 8 8 10 11 9 12 10 8 8 34 12 14 18 10
11 9 5 6 9 8 11 6 9 7 6 11 10 6 9 10 5
6 8 5 10 10 12 11 19 12 11 9 9 9 10 8 13 14
10 11 11 10 11 8 6 8 6 6 6 9 9 8 6 13 12
22 11 11 6 8 8 9 11 13 11 12 9 9 9 7 11 10
9 11 14 11 6 6 8 8 8 22 18 9