S03036-01_F15
Seqid S03036-01_F15
Sequence >S03036-01_F15.phd
NNNNNNNNNNNNNNNNCGCNCTCAAAAAAAGGNGANTGGCGGCGNNTCGGCCGATTGATC
CCGTAAAAACTAATAAATACTACGAAAGTCTCAAAAAATAATAATGAAATTCTCCACTGC
TTTGTCTGTCGCTTTATTCGCCTTGGCTAAGATGGTCATTGCCAATTCCGAAGAATTCGG
CCTGGTGAGTATCCGTTCCGGCTCGGATTTACAATACTTGAGTGTTTACAGTGATAACGG
CACTTTGAAACTTGGCAGCGGTAGTGGCTCATTTGAGGCAACTATTACCGATGACGGTAA
ACTGAAATTTGACGACGATAAGTATGCCGTTGTCAATGAGGATGGCTCATTCAAAGAAGG
TTCTGAGAGCGATGCTGCCACTGGTTTTTCTATTAAAGATGGCCATCTAAACTACAAGAG
CTCTTCTGGTTTCTANCCTATCAAGGACGGGACGTCTTANGTTTTCCNANCNNCNCCCTT
NNACNNCGCCAGGGGNGNTGCGAGNAGAGCAGTTTTNNNNNNAGNTAATAGTANNAGAAA
AAAAATAAGAAGNGAGNCNAGCGTACCTTTATCATATAGAAAGAGGGANANTNNAGAAAN
NACCCCTAANCNCANNCTCGNCGGGNGNGGGGGGGNGAGAATNGTATNAAATTGTTATTT
NAAAAGNAAAAAAAAAAAAANNNGGAGGCNAATCAATNCACTTTNTNGAGGNNGNNAANA
AACNAANCCACGCCAGAACACAAGGGGGGGGGGGGNGGGGNNNGNNGGGGGGGGAGATNT
TTATNNATNNTTGATTNCAAAANAGNCAGAGGAGNNANNAAAAATTGATNGTTTTGANNA
AANGAAAAAAACCAAAAACACCNANNNAANNANGNCCACGNNNNGAGAAAAAGGNNGGNG
CNTNNACAAATAN
Quality >S03036-01_F15.phd
6 5 5 2 2 4 2 3 4 3 5 5 4 5 6 6 9
11 9 6 12 9 10 10 14 12 17 13 8 8 9 10 5 10
15 6 10 15 9 9 10 13 11 9 6 6 26 21 24 26 29
28 17 21 13 14 12 11 17 19 19 16 23 18 18 18 17 15
18 18 27 28 35 18 40 46 37 18 35 31 18 18 28 17 17
17 24 28 27 27 27 36 18 12 15 16 13 13 19 21 18 44
25 21 20 39 21 17 19 14 25 23 14 26 31 22 28 39 52
47 46 46 46 44 46 48 43 43 40 40 35 42 60 53 33 40
52 48 52 42 52 60 40 43 52 39 47 30 35 43 20 52 37
57 48 48 48 60 52 57 57 54 52 42 46 53 48 57 57 45
43 48 46 52 53 35 43 44 35 35 45 48 52 52 57 53 43
43 48 57 57 46 57 52 52 57 52 48 53 43 43 43 48 57
57 44 48 33 60 53 45 53 23 35 34 35 53 41 35 35 53
47 37 43 23 35 34 34 35 27 45 19 45 21 18 19 18 18
28 27 19 18 31 35 28 31 44 48 53 53 53 60 52 60 36
45 53 47 53 42 53 53 40 53 60 60 53 44 53 53 41 45
57 52 57 53 20 53 35 53 53 53 53 52 53 60 53 53 52
53 43 35 53 53 53 42 43 20 53 53 43 44 44 47 53 60
53 53 53 37 37 53 39 39 53 53 13 48 20 20 25 13 23
53 33 52 36 52 53 26 53 47 39 45 32 53 39 35 44 20
29 16 14 31 29 27 19 22 13 19 23 26 10 39 45 35 30
35 22 35 10 22 29 27 27 18 14 13 12 14 19 45 28 52
39 60 52 45 30 23 27 47 35 23 30 44 60 60 52 29 48
17 47 30 21 29 47 28 53 28 45 26 26 42 31 13 23 12
45 32 26 23 12 20 29 19 27 13 16 14 31 28 36 26 35
21 16 30 20 19 30 27 20 28 11 6 9 19 35 16 26 19
9 23 39 60 25 16 18 45 21 9 18 18 9 26 11 15 26
6 11 13 18 19 19 16 11 7 9 6 9 6 6 11 7 23
19 18 9 9 7 6 10 12 6 6 14 10 9 11 11 12 9
14 13 6 11 7 8 9 11 10 9 12 6 10 19 12 9 19
11 11 8 9 11 11 7 6 6 7 6 6 8 9 6 9 13
8 9 11 10 9 9 6 6 9 11 24 13 28 16 10 9 9
11 11 12 14 11 9 10 10 6 9 10 13 7 8 6 11 9
10 11 11 14 10 18 13 9 12 10 9 9 9 8 8 15 18
11 10 11 24 11 10 11 8 11 9 6 10 6 8 6 7 10
9 26 22 16 6 6 10 16 12 8 8 11 10 8 6 9 6
18 11 6 6 9 9 14 10 6 14 12 24 13 5 9 6 12
12 19 20 11 9 11 6 8 11 9 11 13 14 6 8 10 10
13 6 9 10 9 11 14 10 14 12 11 9 9 9 6 9 10
11 11 9 6 8 11 27 35 17 17 27 27 14 16 11 19 18
6 7 6 14 16 11 12 9 9 6 9 10 10 10 11 9 11
6 10 10 8 10 10 11 6 9 6 12 11 8 9 7 7 9
6 7 18 27 6 9 14 9 9 6 13 12 6 12 17 11 16
9 8 8 9 11 9 9 11 8 10 9 9 8 9 9 12 9
23 11 19 19 12 12 11 6 10 40 27 10 6 5 5 22 5
6 30 30 22 28 24 12 10 9 10 8 9 12 6 10 8 10
9 8 6 6 10 9 6 6 10 9 11 11 11 9 6 8 18
11 8 18 5 14 9 7 10 10 10 10 9 16 11 10 6 6
9 6 6 8 8 10 9 9 8 9 11 9 10 6 8 11 12
19 12 9 11 7 5 12 11 12 6 8 12 11 23 14 19 11
19 10 8 10 13 9 14 10 11 10 8 8 5 12 5 5 6
11 11 6 6 9 6 8 7 9 11 10 10 8 5 5 6 7
8 10 8 8 10 8 9 8 8 10 5 7 8 8 6 16 10
7 10 5 5 10 9 14 14 14 14 9 5