S03036-01_F17
Seqid S03036-01_F17
Sequence >S03036-01_F17.phd
GNNNNNNNNNNNNNNNNNGNNNNNAAAANANGGNGATTGGCGGCCAAATCGGCCGAATTA
TTTAAGGACACCTGCTTTTCCACTACACATTTTCGTTATTATATAAAAAAAGACAGCCAA
GTATACTTGTCAACAAAATAAACTCATAGCAATTACACTATAAAAACAATAGCATCAAAA
ATGTCACTAAGAAACATATCAATGATCACAAAAAATTTGCAAACAACTGCCAAGTGTTAT
GTCCCAAAAAGTTCACCTACATCAACAACTATTCCGGTTATAAGGGATGCTAGTACTACT
CAATGTCGCAGAATAACTACCGTCATCAATATTACGAGTCTGAAAGGATATTCTCCATCT
CCAAGAACAGTTCATGATAAGCCAATTGTTATTTGCACTGACAACGAAGAGGTAGAGACC
GTATCGGAGCACGTAAAAGTATAATTTGAATTAATCTACTCTTAACACTGTTCAAATGTA
CGTGTAACGTTTGGACGCGNAAAGANTCTANNAAATTACTTTTTNNANTTATAACCNNNG
AANNTATGTGGGAGGCNGCATCCACAGCTTCNACCGGNCATGATTTAAAGNTNTCCCAAA
AGCNNNAACCNCCCNTTTTAAGGAGGGGGGGGGGAGGGGGAGNANGNANATTTTNAANTT
TTTGNTTATGAAAANAAAGGGGGGGGGAGGANGAANNATCCNGTTNGTTTTGNAGGAAAA
ATAAAAAAAAANTACCCTNNNCNNCCCGGGNGGGGGGGGGGNAGAGGNGGGGGTGTGGAT
TGNTNGTTTTTTTANAATCAAAAAAAANACNAGCGCCGCCGGGTCTATTNCNACGGTGAT
GGGNNAAAGAAAAANNCNCTCNCNANCCTNCCCNNCNGGGNNCGGANNNNGNGNNNGGGG
NGTTGGNANNNCTANGAN
Quality >S03036-01_F17.phd
11 5 5 5 4 5 2 2 3 3 3 4 5 3 5 7 5
7 8 5 5 7 5 5 10 12 8 13 6 9 5 10 8 6
23 23 18 19 20 9 8 9 10 10 11 12 9 9 17 16 17
15 17 22 17 20 17 36 23 12 31 40 24 12 14 18 38 17
17 19 25 24 20 36 32 22 25 27 26 28 15 20 20 17 18
26 21 30 15 32 35 35 30 32 42 42 29 28 27 22 27 25
25 35 27 35 35 35 22 22 18 22 23 17 11 17 27 21 13
27 42 31 31 31 22 27 31 47 49 42 42 44 39 42 27 34
35 34 57 57 57 57 57 60 52 47 57 59 47 52 57 57 57
43 60 57 47 52 48 53 52 57 60 60 60 52 57 46 47 40
40 32 34 47 42 52 47 60 60 47 47 52 57 57 52 60 52
52 52 60 46 52 48 43 43 57 57 57 57 52 57 52 57 53
41 48 52 52 57 57 57 60 57 48 52 52 60 60 57 52 42
52 57 52 23 60 48 48 48 48 43 45 57 48 45 60 21 36
30 21 44 24 30 29 20 30 35 35 47 45 57 53 48 48 60
45 48 52 60 57 53 60 45 53 53 52 44 57 57 48 57 63
48 48 52 60 63 44 48 48 47 48 53 35 53 53 48 32 53
35 48 57 60 57 57 46 45 60 52 53 52 39 35 43 48 35
45 53 60 57 53 48 43 43 45 48 43 47 47 57 41 43 57
57 46 57 47 35 53 35 52 32 59 57 37 37 53 40 40 34
37 48 22 22 26 22 34 35 20 32 13 26 34 24 43 43 20
48 48 37 34 20 18 26 35 40 23 11 23 37 22 20 19 21
21 21 33 35 52 52 48 32 30 40 43 30 36 43 40 53 35
48 53 43 32 37 20 40 60 60 43 35 28 48 48 42 57 57
31 52 32 57 60 60 42 57 29 35 28 43 43 20 47 41 32
23 11 18 11 20 16 31 35 35 20 43 32 43 34 43 29 40
28 52 47 40 40 40 35 40 47 52 35 46 40 60 39 39 24
35 42 35 42 42 46 16 16 19 22 40 11 29 19 12 18 20
29 47 22 22 24 9 16 19 15 17 18 12 12 11 12 12 10
22 11 9 18 9 9 7 9 9 10 11 9 7 11 11 10 9
5 5 15 44 29 18 28 11 13 24 28 40 17 8 5 7 9
6 15 35 15 12 9 9 9 14 7 6 6 21 35 17 7 6
12 22 16 22 16 9 9 9 11 12 10 16 6 12 19 10 9
10 12 8 11 22 9 9 8 10 9 7 9 13 18 19 9 7
9 9 12 9 19 11 10 10 12 9 15 11 6 11 7 9 10
13 9 13 19 37 9 11 8 7 7 7 9 10 9 12 6 10
9 9 6 8 9 9 10 9 10 11 14 8 11 27 46 32 18
11 14 20 13 28 12 35 42 41 13 14 11 9 6 13 6 8
6 9 6 11 8 14 16 10 6 10 10 6 9 11 18 27 12
9 6 9 11 12 15 9 9 10 11 28 6 9 14 8 14 18
20 22 20 9 21 11 9 11 10 14 9 6 9 14 9 6 6
8 9 11 10 7 11 11 11 7 17 14 10 9 13 19 6 11
11 9 14 24 14 20 10 8 10 26 18 40 16 18 30 32 17
7 9 9 14 14 10 8 6 6 5 8 6 6 14 14 22 9
9 16 6 17 23 26 40 27 20 23 24 28 8 6 10 9 8
9 8 6 8 22 19 35 19 9 9 8 10 11 9 14 10 11
6 9 5 9 12 9 8 8 37 17 8 9 6 8 11 9 8
12 34 12 19 9 38 21 11 6 10 8 6 11 9 10 31 9
9 9 12 10 9 16 8 9 9 9 9 9 9 6 11 6 10
9 9 10 9 11 13 11 12 14 9 5 6 27 16 11 8 14
14 16 19 11 6 6 11 6 9 9 8 6 8 6 11 6 11
11 9 5 8 17 9 6 5 9 5 9 9 14 6 6 10 13
8 11 6 5 6 5 8 5 10 6 5 5 18 14 9 9 6
9 14 10 8 8 6 9 6 7 6 9 11 14 7 10 8 5