S03036-01_F22
Seqid S03036-01_F22
Sequence >S03036-01_F22.phd
NNNNNNTTTTTAAGGNNCAANANAANNNNGCGATTGGCGGCCAATCGGCCGAATTGGCTA
TCAATTGCAGAAGGAAAGAGCAAGACATCAGGGACTGATGAACAAGACCAGAAATAAGGG
TCTACTTGAATTGAACGTCATATTTGGTTCCTGTGCTTCTAGCCAAATTGCTTTTTTATC
ATATTTTGTGCATGTGTGTTTATTTAGATTTAGTTGCGATCAAGTGTAGAAACACATTAA
AAACTATGTTGAAAAACATAAAAAGTATTTGCAGATCATTAAACATTAGAATTAACTATT
TATCATTAACTATTATATTAGATATTACTAAAGATTAAAATTTGTCATTNGAAAANNNAA
NAAAAAAAAAAANATATATATTTTAATANAAAAAAAAAANGTACCGGCCATAAGGGCCAG
CTTGAGTATTCTATAGTGTCACCTAAATAGCTTGCCGTAATCATGGTCATAGCTGTTTCG
TGTGTGNGATTGTTATCCGCTCACAATTTCACACAACATACAAGCCGAAAGCAAAAAGTG
TAAAGCCTGGGGTGCCTAATGAGTGAGCTAAAATAACATTAAATTGCCTCTCCCCCTCTC
TGCGCGGGTTTGGAGGGGGGAATCTGGTTGTACCAATCTTATTTTAATTAAACGGGCCAA
CATCCTAGGAAAAAGGAGGNAGGGNTTTTGGGTTNTTATGGGNTTAAATAATAAAAAAAA
AAACCCCCCCTCCACCCCATTAGAGAGAGGGGNAGAGGAGATTAAGTTTTTATTATATTT
TAAGAATACAGAAGTAGGACAAGAGAAGATNGGGGAAANAAAGAAAATGANNAGGAAANT
AGNAATAGACAAAAACCAACACACCCACGACAGCGTNGNNAGNAAATNAGAAATGNNANT
NTAATAN
Quality >S03036-01_F22.phd
5 2 2 6 5 6 15 14 13 9 9 8 9 12 12 7 5
11 10 9 5 10 7 10 10 7 5 5 5 9 12 18 23 18
25 27 10 18 34 23 12 13 10 9 31 27 22 26 28 31 28
27 11 27 34 29 20 20 32 28 38 18 27 29 40 43 36 36
29 32 42 40 36 54 41 49 50 50 54 35 46 35 29 38 38
31 35 29 44 22 27 44 33 22 38 60 47 44 44 42 28 27
31 27 35 42 33 42 42 44 34 44 34 29 42 42 46 42 57
52 57 57 52 60 52 60 57 40 46 60 44 47 60 52 60 52
47 60 57 57 57 57 58 58 60 45 45 57 52 57 57 63 63
63 63 58 60 52 52 52 57 52 60 52 47 57 57 63 57 47
44 60 58 60 57 63 52 52 58 52 52 57 58 58 60 57 60
58 57 58 63 57 63 63 63 63 57 60 57 60 52 57 52 60
52 52 46 52 44 60 40 40 47 60 60 47 47 42 49 47 49
54 60 54 49 60 47 32 38 49 43 33 43 32 43 40 49 50
54 50 50 60 50 50 51 51 63 51 63 54 54 44 49 60 60
49 49 60 54 54 60 49 49 60 58 58 54 42 63 53 51 50
52 53 53 49 50 54 57 57 54 54 54 50 42 52 57 50 49
52 50 50 54 42 50 54 52 43 57 51 49 43 50 50 54 50
57 54 50 50 50 50 54 50 54 54 54 50 50 51 54 57 50
54 43 43 40 49 43 42 42 39 37 26 29 35 28 21 23 29
29 35 35 40 34 29 31 29 26 7 12 11 11 14 8 7 7
5 8 9 6 10 26 32 30 20 19 16 19 12 18 12 7 15
13 11 8 10 9 9 11 12 12 10 10 11 13 20 6 15 21
27 30 29 35 26 28 31 22 6 16 28 12 30 28 41 35 35
27 18 28 18 28 36 37 28 35 35 27 15 17 31 35 26 28
23 30 29 43 35 21 35 23 20 19 18 22 41 30 14 30 20
19 20 51 46 35 18 35 16 28 46 35 26 9 13 20 17 19
18 16 16 9 21 33 28 15 28 25 25 28 23 26 15 28 28
28 11 12 9 10 35 8 25 14 11 7 8 10 21 27 13 11
11 11 14 28 26 9 19 27 18 21 23 21 23 20 21 9 14
22 17 19 18 19 16 21 30 23 30 11 15 11 10 17 16 11
8 17 33 20 12 8 10 13 35 27 26 18 35 31 31 12 17
19 17 20 14 27 22 23 21 23 30 23 22 11 21 16 21 14
14 12 10 13 17 14 11 13 10 22 22 19 9 9 13 11 44
13 12 19 17 19 22 16 11 15 15 16 11 9 11 12 9 13
11 14 10 10 13 15 22 11 11 10 20 10 10 17 25 10 9
22 12 19 14 22 20 16 13 41 24 10 13 20 14 14 23 16
14 14 13 10 13 10 8 14 16 11 13 30 32 14 40 14 14
13 11 19 20 41 24 15 14 14 19 12 14 12 20 11 9 8
14 10 13 19 35 15 19 26 22 18 30 9 11 15 26 11 7
9 11 11 9 6 11 22 15 14 18 8 11 11 9 6 11 11
13 11 9 11 10 6 14 14 9 22 18 9 9 8 11 15 16
32 24 15 19 13 16 13 11 15 10 10 15 15 13 15 18 14
16 11 11 24 28 28 11 11 12 11 10 9 14 10 16 32 27
15 10 15 15 7 10 11 11 16 14 12 9 16 9 11 14 19
8 18 12 20 17 9 11 11 10 16 12 13 23 15 10 14 14
16 13 11 10 8 15 11 10 9 12 10 9 9 15 13 13 14
11 19 20 14 17 9 13 14 15 11 9 7 11 11 11 14 11
11 16 7 19 11 9 10 11 14 9 9 9 9 10 7 6 11
12 20 19 24 14 7 10 15 11 6 16 15 17 13 10 10 11
15 11 14 14 13 11 9 13 10 11 11 10 11 13 17 28 15
12 16 13 11 13 12 13 11 9 7 9 6 6 10 8 7 10
14 9 11 5 8 16 11 10 8 9 14 5 6 8 5 10 5
11 9 16 9 9 6