S03036-01_F23
Seqid S03036-01_F23
Sequence >S03036-01_F23.phd
NNNNNNNNNTTNTTCNGNNNAANNNNNNNNGGNGATTGGCGGCCNATCGGCCGAATTCCC
ATGGGGATCCGATGATCTACAATTACAACTTCATATTTGTCGTCATTAATAGAGTCATAC
TTAGCCTTTAACTCGTCCCAAACTTGTCTATCAATGTGGAACTTTGTAAAGGGATCATCC
ACGTTGTTATTGTGTATAAGTTTGGTGGCTATTTTACCAGTTTGTTTGATCACATCTAAT
TCTTTACCGAAAAGTTTAAAATCAAGAGCTTCTGGCGAATCCCAATTTTGAATGTTATAT
TTAGCATCTACTGGCACTTCATTATCATGTTTGTAAAAGTCATCTTCATGAATTAATGTA
GCCTTCGTGAATAAACTTGCTGTAAGTTTCGCAATTGTCGTCTTACCACTGGAGGAGCAT
CCACTCAATCCAACTAATATCACTTTTTTCGAAGTCATATTTTGAGGTTCTACTCTAGCT
CACACTTCGATAGCTTTTGCACGCTATTTTTTCCCTTACTCTGATAAACTATCGGAACAG
CCTAAAATGNNNGTTGNTNNNTTTCTCAGACCAACTGCCGTTCCTTTCCTGCGTGTANTG
NNNNCNNNTNNNTGAGTCAACGGNACGATCNNNNAANNNNTCTNNGAGTNNNNAANCNNT
TNANAAAGTTANNTNNNNAANNNATGNTNAANNNGNNCANAGAACNNNANANAANNNGNN
ANNGGAGGGNNNGNCATNANNNNNANNTNAATTCTATAAAGANNCAAAANNTGGCGNAAN
NATNNCNNNTGNNNNGNANAAATNANAAC
Quality >S03036-01_F23.phd
4 5 3 3 5 4 4 4 4 12 12 5 18 13 8 5 8
7 5 5 8 8 6 7 7 5 5 7 7 6 22 22 6 27
25 14 28 42 16 13 42 18 12 10 7 9 36 43 50 19 25
46 43 30 11 21 41 29 36 28 19 50 52 49 50 50 14 10
42 38 42 43 26 49 29 16 52 50 40 50 20 51 52 50 43
50 31 42 49 47 52 42 27 54 59 54 54 49 52 54 57 50
54 50 46 50 42 46 49 49 43 49 51 51 54 59 59 59 59
57 54 57 50 59 49 43 46 51 42 54 54 50 54 59 59 54
59 57 50 42 50 57 59 59 57 53 57 57 50 57 54 57 50
47 53 59 59 57 53 53 54 42 59 57 57 57 50 54 51 57
57 53 53 39 31 54 59 59 49 45 49 54 54 57 51 50 57
43 54 50 57 59 59 59 54 59 54 54 53 53 53 53 53 53
53 52 53 42 42 52 52 52 52 52 52 52 49 45 42 53 53
53 53 52 49 53 53 52 50 43 52 46 52 46 52 52 50 46
43 42 49 52 52 52 50 52 46 52 52 52 53 51 52 52 52
53 52 52 52 52 52 52 52 35 52 52 52 52 50 52 51 49
52 52 53 52 52 53 53 46 37 46 46 35 42 49 53 53 53
52 42 50 43 50 33 49 46 37 46 46 53 51 36 49 49 46
51 40 47 42 49 49 49 51 49 50 46 46 46 42 41 42 53
37 46 46 40 50 52 41 52 52 49 36 41 52 52 52 42 46
41 30 50 46 36 46 32 30 49 49 29 17 27 41 25 23 33
43 30 46 37 37 46 40 51 35 41 49 45 23 28 36 34 52
52 49 49 43 49 46 49 50 37 41 43 36 50 43 46 34 30
46 37 49 36 49 49 41 50 50 37 49 32 49 40 37 49 34
51 50 49 51 26 26 47 42 16 40 33 46 32 49 32 46 49
37 14 40 31 36 37 23 35 46 37 21 49 46 46 35 28 31
34 46 51 51 49 49 45 28 23 41 23 26 34 28 26 36 38
25 21 20 27 40 35 26 43 20 49 32 34 40 47 49 35 27
38 32 37 42 34 37 34 38 42 42 29 31 21 41 34 26 34
30 29 41 41 45 29 29 30 49 32 36 30 30 20 17 25 20
17 17 13 8 20 14 41 28 21 38 32 32 35 35 21 19 22
37 30 35 32 35 28 29 22 15 15 29 14 16 31 30 30 13
12 18 24 20 32 6 3 7 13 20 20 9 3 8 3 7 7
10 14 35 23 28 26 21 9 40 9 23 15 23 23 30 29 23
21 21 9 17 16 14 9 20 14 13 26 10 28 22 27 27 30
13 8 7 32 13 5 5 3 5 9 6 7 5 20 7 3 3
8 18 15 10 13 17 21 25 17 11 8 5 19 30 21 16 15
9 6 5 7 5 12 9 7 5 5 5 18 22 23 7 5 9
14 10 9 5 5 5 7 13 17 6 11 6 5 8 9 6 10
5 8 13 17 9 15 26 9 6 6 8 5 3 3 7 9 26
5 5 5 8 8 8 5 14 6 9 9 5 5 5 9 5 5
10 10 6 13 10 15 10 9 6 6 6 17 6 10 6 11 13
7 6 6 8 6 6 9 6 5 9 11 18 18 16 17 5 5
6 19 6 15 11 10 6 12 6 6 5 7 5 9 6 6 8
5 14 14 9 10 12 11 19 9 15 9 9 16 10 7 7 13
8 11 13 9 5 5 9 14 10 9 12 6 16 14 6 6 9
8 6 6 9 6 6 6 9 8 5 5 6 6 9 6 9 6
15 13 9 13 6 10 6 8 8 11