S03036-01_F24
Seqid S03036-01_F24
Sequence >S03036-01_F24.phd
NNNNNNNNNNNNTTNNNGGGNNNNNNNNANNGGGCGATTGGCGGCCAAATCGGCCGAATT
TGACGCAGACTCAAGTTGCAATAGGCTAAAGATAAGGCAGACACTTTAGATAAAAAAAAA
AAGGAATTAAGATTTCATAGAGAAAAGATGGGTCTATACGCTTCTAAGTTATTCAGCAAT
CTTTTTGGCAACAAAGAGATGCGTATACTTATGGTTGGTCTAGATGGTGCCGGTAAGACC
ACCGTTTTGTACAAGTTGAAGTTGGGCGAAGTTATCACTACCATTCCAACCATTGGTTTC
AACGTTGAGACTGTCCAATATAAGAACATTTCCTTCACTGTCTGGGACGTCGGTGGACAA
GACAGGATTAGATCTTTATGGAGACACTACTACAGAAACACCGAAGGTGTTATTTTTGTC
ATCGATTCCAACGATAGATCGCGTATTGGTGAAGCCAGAGAAGTCATGCAGAGAATGCTG
AATGAAGATGAATTGAGAAATGCTGTCTGGTTAGTCTTCGCTAACAAACAAGATTTGCCA
GAAGCCATGTCTGCTGCTGAAATCACCGAAAAATTAGGTTTACATTCTATTAGAAACCGT
CCATGGNNTATTCAGTCTACTTGTGCNACCTCGGNNGAAGGTCTGTACGAAGGTCTGGAG
TGNGTAAANGAGANTTTGAAAAATCACTCATTAAGCTAAATTTGTAAAANAATTTAAAAA
TGCGGAGAAACTAAAGTTNGATGNGAAAANGGAATAAATNAATAATCCACAAAAAAGAAG
AAAGATAAGGTTGGGGACCAGGGGCAAGGTNGGGGNTGTATCGNAANGGGCTAGATCCAN
NCAANAGCNGCGCGGNGGGTNAGGGGAAAGAAA
Quality >S03036-01_F24.phd
4 3 3 3 3 3 4 3 2 3 3 3 9 18 7 3 5
15 16 8 5 5 5 3 7 5 5 3 8 7 7 8 26 23
10 25 29 16 33 43 15 14 47 32 21 24 22 32 26 42 42
51 29 42 48 41 34 14 27 50 50 41 21 19 41 46 31 29
25 24 50 36 32 49 47 49 49 51 50 49 43 46 50 50 44
46 28 25 20 19 26 26 28 51 47 46 44 54 36 36 39 43
46 44 54 54 42 54 43 42 50 54 54 54 54 59 59 59 51
46 46 51 57 57 57 42 45 50 49 49 46 39 45 57 52 52
54 54 57 50 57 54 57 57 57 59 57 54 41 57 53 57 59
57 57 59 59 59 57 59 57 57 57 57 46 54 57 54 57 57
59 57 59 57 54 59 59 59 59 59 59 59 57 53 53 57 57
57 59 59 54 57 50 59 57 57 57 52 45 54 57 57 57 59
57 49 57 57 57 50 49 49 51 57 54 50 57 57 54 57 57
57 59 57 57 57 57 59 57 52 53 53 57 54 57 46 50 45
44 50 54 46 43 49 50 49 57 57 57 50 49 49 50 53 57
59 59 57 53 57 57 59 59 57 53 51 50 59 59 57 44 57
57 49 50 57 54 52 57 57 57 50 50 57 57 57 44 39 50
51 50 52 57 53 53 57 57 57 57 59 42 50 50 54 57 53
50 57 50 45 44 49 57 54 49 44 39 57 54 50 50 54 57
50 51 49 50 54 50 53 49 46 46 49 57 54 37 50 49 57
50 54 54 57 53 45 39 38 49 49 54 42 57 54 50 51 42
29 50 50 49 42 42 54 50 53 39 32 57 54 54 50 50 59
54 57 50 43 49 57 57 50 33 39 29 35 45 46 49 49 49
54 50 50 50 50 51 46 49 42 47 46 40 43 46 35 47 42
54 54 54 50 42 51 51 49 49 50 33 50 35 54 42 49 42
33 49 39 30 14 49 50 50 50 42 54 49 50 42 54 54 50
49 40 54 42 54 54 50 43 49 40 49 35 39 40 32 42 50
18 50 49 42 50 35 28 36 46 39 33 29 50 35 45 46 39
46 35 49 46 25 34 42 54 50 46 35 49 32 50 42 42 40
42 32 39 39 49 42 41 37 49 30 50 50 50 42 46 42 41
21 40 26 33 37 37 30 41 33 22 33 39 39 32 39 26 47
54 31 25 21 27 31 13 21 23 24 27 29 35 32 34 27 20
9 10 34 35 40 35 28 39 35 42 25 28 22 42 42 46 28
17 26 17 13 17 21 26 37 32 28 35 32 27 21 10 17 30
25 35 16 14 13 9 17 16 35 36 38 42 28 21 9 10 27
21 29 13 17 9 8 21 19 21 18 27 6 6 10 11 13 9
11 8 12 18 15 18 18 20 17 21 22 25 44 24 6 11 18
16 9 11 27 20 7 7 12 23 28 16 24 25 16 13 15 12
16 14 9 31 17 22 11 9 17 11 14 29 20 19 15 9 6
9 11 10 10 9 6 10 9 9 9 6 9 10 10 11 18 29
11 27 13 12 13 9 8 9 10 11 10 10 12 16 9 9 14
9 26 10 14 16 15 13 10 10 11 12 9 6 11 16 11 19
11 15 14 14 11 13 17 20 11 9 11 11 9 11 13 10 10
10 11 10 8 11 13 11 6 9 11 13 14 7 10 10 10 9
13 6 9 13 9 9 13 14 24 10 18 6 10 11 9 11 11
11 9 14 11 10 18 18 14 25 14 10 14 14 26 17 16 10
9 9 9 8 20 12 25 14 11 12 9 10 13 11 10 9 11
8 11 10 17 10 8 14 9 14 23 10 7 9 10 17 12 7
11 11 10 11 9 14 9 6 14 16 6 9 12 10 18 16 27
15 11 10 11 10 11 6 6 10 15 9 6 10 9 13 6 9
9 14 9 9 9 6 11 9 9 9 6 10 9 10 15 10 16
13 10 16 10 20 12