S03036-01_G01
Seqid S03036-01_G01
Sequence >S03036-01_G01.phd
NNNNNNNNNTTNTNNGNNNNNNNNANNNNGNGATTGGCGGCAATCGGCCGATTTGAGAGA
ATCANGACGATGCAACCAAGATCAAATAGGAGAAGCTGCTCCTATATACCACTCGGGGTA
CATAATAATACCGAAAAGAGCTTGTGCACCGAAGTTGCTCCAGCAAGAAAGAACAAAAGG
TCTATTACGACTTCTCCCATAGTCAACATCAACGTTGTAGAAAGAAGACTGTTTAATTTG
GAATTGGAAAAACAACAACTTCGTGCCAAAAATCTGTCTGAGAACACAGGTAGCGGAAGC
CCCAATGGGGGTGCTTATCTGGACGCCAAAAAAGGAGTAAGAGAACAAGATCAATACCAA
GGAGCTCCCTCGAAAGAACTTGACAGGCTACAACCACCACCTTCAATGAAGAAAAGCCCT
CCAAGGAAGAAGAAGAGCCTAAAGGACTTGATATATGAAACGAACNAGACATTCTATCAG
GGGGAGNNNNGAAGGTTAAATATAAGGNANGTCTATCNAAGAAACAGCTATTACCATCCG
AAACGGTNAANACTAAGNCAGAGAAGAAANGTTTTGAAAAANCNNTGGTACGCTCCACNT
GNGTGGGGTNGNNNGGTGTCNGANATTTNAGCGNATANNGCAAAATTANAANGCAGGCCG
AGCANNGCTNANGCAAGANNAGGGGTAGGGGAGNGNNGAAANCCCATGNCCTCANGCCCC
CGNNAGANGGGNGNGNTGGTTTGATTTTTGANTGATNTGTAGGNGGNANTAGAAAAGNCT
CNTTGANACGNTCNAGCTGGAAGANNTNAGGGGGTGANAAANGNTTNTTACANCCACGGG
TNGGNGGGNGGGGGCGGNNGGAGANTTTTGGGAGGANAGTTANNNTN
Quality >S03036-01_G01.phd
5 5 4 5 7 4 3 2 4 12 15 6 8 4 4 9 5
6 5 5 5 7 5 5 8 5 5 5 5 9 6 24 26 20
21 31 12 12 12 14 8 8 11 19 17 26 20 14 22 20 19
9 23 22 10 9 11 14 13 26 22 16 15 9 6 11 21 11
28 35 19 34 28 24 27 31 32 17 32 21 24 28 29 15 18
28 32 29 32 27 25 11 19 16 16 30 34 34 30 28 34 26
20 20 20 16 15 16 26 22 23 19 35 32 31 41 20 23 30
21 26 19 29 25 35 29 26 25 37 32 41 46 43 35 42 35
42 36 42 42 42 49 46 49 54 50 46 42 32 49 45 42 46
26 51 43 43 32 50 46 49 35 46 50 39 32 44 44 44 43
46 44 46 42 39 47 60 60 50 49 42 47 45 47 50 58 42
47 60 63 44 49 63 49 47 60 43 43 35 52 42 42 45 43
31 44 40 32 43 52 35 57 57 35 57 46 40 40 48 48 43
30 43 60 35 22 40 48 21 23 57 35 23 8 12 11 21 11
13 21 48 43 33 34 63 48 43 48 52 48 60 57 60 60 48
43 40 43 48 57 57 57 47 57 57 48 48 35 63 53 43 53
43 60 52 52 60 60 57 60 58 20 53 53 46 60 57 60 52
63 42 57 53 57 60 60 48 43 48 48 48 43 43 43 57 57
48 43 33 48 52 57 52 52 48 48 60 57 57 60 60 57 52
46 52 52 48 47 52 48 57 60 48 57 57 52 46 57 42 57
52 52 42 52 52 60 39 42 47 35 20 21 22 28 35 28 29
35 35 47 48 63 32 23 43 52 42 60 48 57 42 48 31 43
35 29 42 40 36 40 40 35 29 47 35 35 43 23 35 16 35
17 35 43 43 41 60 48 44 46 60 57 60 46 41 52 47 42
47 47 47 46 46 47 42 42 34 23 35 40 17 29 17 42 46
47 32 34 29 28 25 22 25 28 39 47 21 17 42 31 28 60
42 36 35 28 13 22 46 33 11 12 18 22 22 27 16 19 17
15 11 9 10 11 9 7 16 11 10 10 9 31 27 19 13 15
13 14 9 23 22 11 22 22 17 9 7 6 6 6 8 9 8
14 18 9 9 9 35 33 24 10 16 31 35 9 9 7 9 7
11 23 16 39 27 20 13 7 9 20 21 19 10 17 11 25 20
24 19 28 19 18 11 12 27 16 35 9 9 9 10 25 21 18
20 33 16 7 9 11 7 12 9 16 11 16 9 7 9 11 13
27 19 28 9 9 20 9 12 6 8 13 15 15 28 31 27 44
35 22 8 7 8 7 6 14 12 10 9 9 11 9 15 9 24
17 10 11 6 10 15 7 11 9 17 14 14 9 9 6 9 7
6 6 17 18 12 17 18 9 6 9 11 7 9 16 16 9 6
9 10 9 9 6 9 12 9 6 6 20 18 9 10 11 9 9
13 13 6 10 11 7 10 8 12 19 10 9 9 10 9 10 13
14 6 7 10 10 11 6 11 6 14 15 11 8 9 9 6 6
10 10 9 9 12 12 10 20 20 16 11 10 9 6 10 6 6
14 11 9 11 6 11 10 13 14 15 9 6 13 13 9 9 10
6 9 10 11 10 14 9 13 6 7 11 11 11 6 11 10 19
6 16 6 9 6 9 9 13 8 13 12 18 11 11 10 13 26
13 9 9 6 14 10 10 23 6 9 14 22 35 9 9 6 10
9 7 10 7 9 9 13 27 17 28 8 9 6 16 10 16 7
10 16 9 9 6 11 11 9 6 10 9 7 11 10 8 9 22
14 11 9 9 9 6 6 11 6 11 18 8 11 14 9 8 9
10 6 21 11 10 6 9 7 11 9 6 11 16 13 14 9 6
9 8 10 8 9 12 10 11 7 9 9 6 12 17 8 6 12
44 46 40 12 8 19 13 7 6 23 16 11 19 9 6 9 8
10 8 8 8 10 8 8 9 9 6 12 8 11 10 8 6 7
6 8 6