S03036-01_G02
Seqid S03036-01_G02
Sequence >S03036-01_G02.phd
NNNNNNNNNNNNTTTNTNNGNNNNGNNNNNNNNGGCGATTGGCGGCCAAATCGGCCGAAT
TGAAGGATAACAAACATCTTCTTTCGTTCGCTTCAAAATAACTACAAATTAAAAATGCAA
TTCTCTACCGTCGCTTCTATCGCTGCTATTGCCGCTGTTGCCTCCGCCGCTTCTAACATT
ACCACTGCTACTGTCACAGAAGAATCTACCACTTTGGTCACTATCACTTCCTGTGAGGAC
CACGTTTGTTCTGAAACAGTTTCCCCAGCTTTGGTTTCCACTGCTACCGTCACCGTAAAT
GACGTTATCACTCAATACACCACCTGGTGTCCATTGCCAACCACTGAAGCACCAAAGAAT
ACCACTTCTCCAGCTCCAACTGAAAAGCCAACCGAAAAGCCAACTGAAAAGCCAACTGAA
AAGCCAACCCAACAAGGTTCTAGCACTCAAACTGTTACCTCCTACACTGGTGCCGCTGTT
AAGGCTTTGCCAGCTGCCGGTGCTTTGTTGGCTGGTGCTGCCGCTTTATTGTTGTAATTT
ACTCAACCTTTTCTTTAATATATTTTTAGAAAAATGGTTAAGTACTTTTCCGTCAATACA
GCTTCCACAAAATCCTTTTATTTCAATTAATAAAGATATTCTGGTAATTTCTTATTCTAA
TTCTAGGNGNAACACTCCATNACTAAATGTTNTTATAATAATANTNATATAAANTNATAT
CTCTNNGTTACACNNNNCNCCATACGAGAGAAAAAAANAAAAAGAAANNNAAAAAAAAAA
NNTCCNGNNNTAGNGNNNGCTTGAGTATCTATAGNNNCNCTANNANCTGGCGTANNNNGN
TCAACNTGNTNCTGNGGGAAANTGNTATCGN
Quality >S03036-01_G02.phd
6 2 2 2 2 2 3 3 3 3 5 5 16 15 12 5 8
5 5 13 5 7 5 3 8 5 3 3 3 3 5 7 6 14
22 9 22 26 12 31 37 11 11 41 21 14 21 19 31 26 37
31 32 21 38 34 35 27 16 30 35 34 20 17 33 40 15 11
42 46 32 32 51 49 35 42 43 52 52 49 49 52 49 49 49
49 40 41 50 31 29 42 42 29 26 45 49 49 54 54 46 49
42 42 50 42 54 50 42 31 35 28 31 27 31 32 42 39 28
21 29 46 37 46 49 42 54 50 49 49 49 49 49 49 51 53
49 51 42 51 46 50 50 51 50 52 42 49 53 53 51 50 59
50 42 42 53 53 53 50 50 53 53 53 53 47 53 57 57 57
53 43 45 42 46 57 57 51 57 53 50 57 51 50 57 57 53
57 57 59 50 57 57 57 57 54 54 54 52 57 53 50 53 47
42 57 50 53 49 50 49 57 57 53 51 57 57 54 57 46 42
51 49 57 52 54 54 49 51 57 57 54 57 54 50 44 42 49
30 29 40 32 21 39 46 39 41 51 43 49 51 49 53 49 53
49 54 42 59 59 57 47 49 59 54 54 46 54 49 57 53 49
50 57 50 57 57 46 49 37 52 52 49 46 50 52 52 53 52
52 52 43 46 53 52 49 49 51 53 50 52 52 38 52 46 51
49 49 49 46 52 52 50 35 49 50 52 49 43 46 49 41 52
52 49 52 52 42 49 35 49 53 35 49 53 49 43 52 28 53
43 51 37 51 49 50 52 51 46 52 33 37 53 32 50 49 43
50 49 35 50 42 52 46 52 52 53 49 49 49 49 36 49 52
52 43 49 35 53 52 52 49 39 53 53 53 46 50 49 35 52
52 52 49 51 52 52 53 42 42 49 34 52 42 50 49 44 53
53 53 42 37 49 34 52 37 51 51 43 50 51 46 35 40 52
26 52 36 51 50 32 50 42 30 52 49 51 28 51 46 50 42
49 50 50 42 49 43 26 47 46 46 46 51 51 49 36 34 39
50 40 51 38 46 36 35 36 40 49 46 36 49 36 39 31 36
47 44 35 45 35 46 26 50 28 42 39 49 28 23 43 30 28
37 49 40 28 16 23 53 30 37 32 29 43 41 41 28 45 41
22 23 49 41 33 29 33 28 46 36 34 44 31 40 26 17 21
31 33 26 29 11 45 42 28 27 34 15 41 41 36 34 46 32
21 41 25 43 29 29 22 41 28 19 31 41 18 44 26 37 32
28 33 34 37 37 43 26 30 26 17 22 15 16 19 28 32 16
41 32 43 26 38 32 32 32 34 39 45 25 28 32 32 34 17
32 32 28 27 16 34 37 23 15 13 16 26 26 11 15 17 40
23 14 15 19 20 12 15 17 17 30 30 15 18 32 24 30 17
21 18 18 15 12 29 30 13 30 23 23 26 30 31 40 17 26
14 13 10 8 12 8 20 24 25 23 29 27 22 21 14 42 27
25 17 24 27 7 9 6 10 36 25 17 36 30 23 27 17 17
7 8 15 26 15 18 20 24 36 8 10 6 12 33 25 26 19
27 34 36 41 26 23 5 9 7 35 18 23 8 10 25 36 6
10 3 9 13 29 30 34 29 13 12 5 3 15 10 19 13 21
8 15 7 5 3 5 13 6 9 11 12 16 16 9 10 9 9
15 9 11 9 14 9 9 13 16 6 15 14 12 16 10 9 12
9 20 7 6 5 9 22 9 11 12 12 21 9 9 8 5 7
13 10 18 7 19 3 3 7 10 12 8 6 17 5 3 6 11
9 19 10 15 13 14 9 10 29 10 9 11 9 16 14 5 3
5 8 5 17 9 14 6 7 26 5 8 15 9 27 10 19 10
15 5 3 7 5 10 6 9 10 10 8 8 7 9 8 6 9
3 13 8 15 5 8 8 8 23 32 14 7 8 8 5 8 8
9 15 9 7