S03036-01_G06
Seqid S03036-01_G06
Sequence >S03036-01_G06.phd
NNNNNNNNNNNNNNNNNNGGGNNNGAANNNNGGGNGATTGNGCGGCCAAATCGGCCGAAT
TGAAGGATAACAAACATCTTCTTTCGTTCGCTTCAAAATAACTACAAATTAAAAATGCAA
TTCTCTACCGTCGCTTCTATCGCTGCTATTGCCGCTGTTGCCTCCGCCGCTTCTAACATT
ACCACTGCTACTGTCACAGAAGAATCTACCACTTTGGTCACTATCACTTCCTGTGAGGAC
CACGTTTGTTCTGAAACAGTTTCCCCAGCTTTGGTTTCCACTGCTACCGTCACCGTAAAT
GACGTTATCACTCAATACACCACCTGGTGTCCATTGCCAACCACTGAAGCACCAAAGAAT
ACCACTTCTCCAGCTCCAACTGAAAAGCCAACCGAAAAGCCAACTGAAAAGCCAACTGAA
AAGCCAACCCAACAAGGTTCTAGCACTCAAACTGTTACCTCCTACACTGGTGCCGCTGTT
AAGGCTTTGCCAGCTGCCGGTGCTTTGTTGGCTGGTGCTGCCGCTTTATTGTTGNATTTA
CTCAACCTTTTCTTTAATATATTTTTAGAAAAATGGTTAANTACTTTTCCGNCNNACAGC
TTCCNCAAAATCCTTTTATTTGNAGTGGNAAGAGATTCTGGNATTTCTTTGTNTAATTCT
AANNAGAAACANACANAAAAGAAAATGGNTATTTAATTNAATTAATNNAAAGNTAANTTA
ATTNNAATTAAGCAAAAACAAANTGCGGNAGGAAAGGAGGGAAGNAGGAGGAAAAAAGTT
TNTAAGNTAAAGATCAATGGAACNTANCGAAGGGCTCCACGGAAATAAAANAGGGATTNG
GGNAAGAAAGNGCTAACCACTGACAANGGGGCACNCNNCGGATGAANGGNAAAAAGNCAT
GTTTAAAGGTACTGGATGTATANGA
Quality >S03036-01_G06.phd
5 5 4 4 3 3 3 3 3 3 5 7 5 5 5 5 6
6 10 12 9 6 6 7 9 9 8 5 5 5 5 10 18 9
6 20 41 14 32 17 6 10 9 29 17 11 26 21 26 22 31
30 31 25 31 35 28 27 16 30 36 24 13 15 15 33 14 9
30 36 30 28 28 30 32 28 33 33 33 41 40 40 37 35 42
38 27 34 36 27 42 43 42 30 20 29 32 37 31 27 26 42
32 28 34 31 27 30 32 36 22 22 18 20 19 12 24 22 15
18 29 35 27 35 39 28 35 36 35 43 43 46 44 50 49 45
46 44 44 49 54 50 50 50 46 44 44 50 44 49 50 44 44
44 41 44 45 46 49 49 44 43 44 43 43 54 54 49 49 50
54 50 50 44 50 49 50 50 50 44 42 44 44 50 50 44 50
46 44 50 44 50 57 59 50 50 49 50 57 57 53 50 57 47
44 54 54 54 50 45 44 49 50 54 50 45 47 46 49 42 44
50 54 54 50 54 50 50 50 50 50 43 54 49 51 44 50 39
28 13 15 17 15 26 27 19 19 43 35 27 32 42 59 59 54
54 54 50 50 57 57 44 50 39 42 42 39 42 43 49 53 49
43 42 49 51 43 49 40 49 42 50 54 54 50 50 42 39 40
51 54 54 49 49 57 50 54 54 49 50 50 50 42 50 49 53
43 54 50 50 49 50 50 54 50 49 49 54 50 50 50 54 35
42 35 53 54 54 57 54 50 49 35 50 57 50 35 50 38 54
43 50 33 49 46 49 50 49 46 49 27 42 47 20 42 46 42
50 49 50 50 35 36 35 42 39 39 39 31 29 30 28 46 43
50 42 50 21 50 46 51 50 42 39 42 49 43 33 39 35 42
39 39 37 50 46 40 40 32 32 40 32 46 46 54 50 42 53
43 49 38 54 52 33 51 42 54 54 42 47 46 49 42 49 49
30 49 39 45 45 39 49 49 37 54 54 50 46 46 39 46 50
54 49 43 42 49 39 31 44 50 39 49 50 42 50 50 34 44
44 38 44 29 36 35 43 42 42 44 44 36 43 20 15 27 30
35 42 35 44 32 33 32 42 27 36 44 43 34 20 27 35 42
35 35 43 18 39 44 44 15 38 23 19 20 29 46 22 43 20
38 39 47 47 43 27 32 27 36 26 35 35 27 39 30 25 38
24 21 32 42 21 15 16 7 8 11 16 19 21 20 28 28 12
26 16 16 24 42 33 23 35 35 42 42 32 38 39 34 35 21
28 35 39 27 25 25 35 27 20 29 31 32 19 30 28 16 15
11 9 6 9 38 28 17 22 24 28 17 18 13 7 11 6 7
10 14 16 12 22 35 21 14 24 7 17 12 22 16 24 16 18
20 19 18 24 18 22 19 18 11 9 7 11 14 12 8 10 6
27 9 20 28 10 11 10 12 19 9 11 8 6 11 11 19 20
10 23 11 9 11 11 6 11 9 10 32 27 10 19 19 10 6
7 8 18 9 13 18 13 14 6 9 9 9 6 9 9 20 20
9 9 16 20 14 17 20 9 6 14 11 9 12 19 11 16 22
11 6 10 13 12 13 12 14 9 6 6 16 24 14 9 7 22
16 15 5 8 9 10 10 11 17 7 6 19 14 10 10 11 15
13 9 9 10 9 16 10 10 15 13 11 7 9 9 10 10 15
7 10 11 18 9 10 14 10 11 11 18 14 12 17 10 9 6
18 19 14 10 11 10 13 14 22 11 14 11 11 11 9 12 6
11 11 10 9 6 9 9 12 9 8 9 8 9 10 16 9 21
13 12 16 9 7 14 13 7 8 11 16 11 14 14 10 10 11
14 14 9 11 15 10 16 11 14 8 9 10 10 12 6 10 18
11 11 10 10 9 6 9 14 12 7 24 13 8 12 9 12 9
6 10 8 10 13 13 11 14 12 12 9 9 9 9 9 11 7
9 15 9 9 12 16 19 6 9 6 6 8 10 10 13 11 9
11 14 6 9 11 6 8 11 8 8 19 9 6 11 25 10 9
10 10 10 9 9 9 9 12 14 11 11 11 8 9 9 8 11
9 9 9 10 7 9 8