S03036-01_G08
Seqid S03036-01_G08
Sequence >S03036-01_G08.phd
NNNNNNNNNNTNNTNNGNCNAAANNATANGNNGATTGGCGGCNNATCGGCCGAATTTGAC
TGTGTGAAGCAAAAGAAGGAAGACTAAAACTCTAAAATTAGTTAAACTAGTGTTTTCAGC
AAAATGGTTTCCCAATTATTCGAAGAAAAAGCTAAAGCCGTCAACGAGCTACCAACGAAG
CCCTCCACTGATGAATTATTAGAGTTGTATGCTCTGTACAAGCAAGCCACTGTAGGTGAC
AACGACAAGGAAAAGCCTGGTATTTTCAACATGAAGGACCGCTACAAGTGGGAAGCCTGG
GAAAACTTAAAAGGTAAATCCCAGGAAGATGCCGAAAAGGAATACATTGCCCTTGTTGAT
CAACTGATTGCCAAGTACTCCTCTTAGAAAAGGGGTATACTAGCTCCATGTAAGGAGTTT
TGGCCTAGCTTTCCTTGTTACTATTCTATTATTATATTTTATTGGCTGCNAAAACCTGAC
TNATGTACATTTAGAGNNGCCCGGATCCCTTTCCNCTCTCCTTNGGGACAAGNCGTANNN
AAAAGNTAAAAATGGCCCTTAAATAAAANGTAATAAAAANAAAAAAAAATAANAANTATA
CCCCCCNCNCCGNGGGAGGGGCCGGNNGGGGAGGNNGTCTTTTNNTNTTTATTNAAAGAC
NAAAAAAAATGTCAAGAAAGGATGGGTATGATTGGGATACAAANAAGAAAGANGCACTNG
NTAACATATNNAAGCCANNANGAGNGNGNGGGGGGTGAGGTGNNNNTTTAAAATNTTATT
AAAAGAATNAAATAGCAANNAGGGTCTATNCTAGCAGGGTTAATATTTAGGTAGAAGNCC
CACCTTCATTACNNAAAGNCNANGGCCGAAAGAAAGANATANCGACGGCATGACATTTAT
AAAAGATTTACGA
Quality >S03036-01_G08.phd
6 5 5 4 5 2 2 2 4 5 21 5 5 8 5 5 8
6 10 6 9 9 8 5 5 8 8 10 5 10 5 5 15 28
14 24 22 13 15 27 10 8 5 5 9 26 27 26 24 19 21
9 10 9 17 49 18 12 14 11 28 41 33 35 31 30 16 12
15 16 21 21 35 31 14 27 42 33 50 44 41 33 27 16 25
22 12 27 39 44 42 43 38 24 28 31 27 31 35 28 27 35
29 22 24 24 35 31 23 27 25 44 22 22 24 44 34 35 34
43 46 42 43 42 52 57 42 42 60 47 42 47 39 44 39 47
45 47 52 47 47 32 46 47 34 52 46 47 57 57 47 52 52
52 60 47 52 52 57 57 60 47 47 44 57 42 35 40 52 52
46 52 52 52 60 47 44 47 42 35 47 60 47 50 47 42 42
42 44 58 58 46 46 58 60 50 57 60 45 47 50 60 51 51
60 51 49 54 47 44 47 47 49 47 42 49 42 42 49 35 47
60 50 47 47 49 49 47 47 47 47 47 39 35 35 43 37 35
25 18 14 24 32 42 44 47 39 60 60 49 50 54 49 44 42
42 47 60 49 47 47 42 47 60 60 47 42 31 60 50 47 49
54 50 60 47 60 44 25 60 49 50 50 50 54 50 49 50 60
50 49 47 50 49 50 47 60 60 60 60 47 44 47 38 36 38
47 49 35 50 47 60 49 47 47 42 60 63 49 49 43 43 42
44 60 50 49 42 44 16 41 47 43 41 47 60 47 43 33 33
33 33 32 42 47 19 33 21 32 37 34 21 38 38 43 31 33
44 42 35 28 22 19 23 36 34 35 39 44 47 24 35 36 35
60 43 43 40 50 47 47 50 47 46 38 30 22 20 13 13 13
23 33 35 35 44 29 52 42 46 42 46 27 40 40 52 35 21
47 57 40 35 35 27 41 33 21 37 35 34 32 40 19 12 22
47 42 35 40 52 35 29 15 29 22 21 19 16 29 23 16 23
16 20 16 19 12 13 30 29 14 16 27 26 11 40 17 17 26
20 17 12 12 22 20 12 22 27 22 6 22 12 11 16 28 16
20 10 11 20 9 6 13 8 16 9 16 13 22 13 14 12 11
12 13 12 6 7 12 9 11 9 10 9 11 10 9 11 9 29
19 9 9 10 7 10 14 10 20 19 13 9 11 6 9 14 11
10 9 10 15 9 7 9 15 9 11 7 6 7 15 10 8 9
11 6 12 24 37 22 22 22 18 14 11 15 9 11 11 10 10
10 9 10 11 9 9 10 6 9 9 11 12 9 11 13 13 20
18 6 11 13 34 37 32 41 32 12 20 17 31 23 6 12 16
6 9 20 10 8 10 10 9 11 12 13 6 9 6 9 12 9
6 10 9 13 13 11 18 12 9 11 10 21 15 6 7 18 11
23 8 8 9 11 6 6 9 11 10 11 24 14 8 6 6 8
6 11 11 13 10 15 11 7 9 10 10 9 11 9 6 21 17
33 23 14 16 10 10 9 9 11 8 9 14 10 22 15 16 20
14 12 20 10 20 14 13 12 8 8 9 9 13 11 9 12 11
10 10 9 14 14 14 6 14 9 12 14 17 9 9 9 6 11
11 9 9 11 7 9 6 8 9 9 12 10 10 9 11 6 7
14 10 11 9 8 8 6 6 11 6 11 9 9 6 14 6 12
6 10 16 12 26 23 18 9 14 8 10 14 9 11 6 7 6
6 11 14 9 10 9 19 18 11 7 9 9 8 9 11 10 10
14 12 9 13 26 10 6 11 9 11 8 15 10 8 11 10 6
6 18 10 9 9 16 10 9 15 13 6 9 9 9 18 14 10
12 11 20 11 8 16 9 8 14 8 11 10 28 17 9 11 11
16 22 8 9 6 11 11 10 10 9 11 10 9 9 9 9 9
12 8 5 6 12 8 8 9 6 11 6 8 6 9 8 8 9
10 8 8 9 9 9 10 9 9 16 6 11 11 12 6 9 10
8 8 14 10 11 14 8 9 10 11 8 9 10 9 10 8 9
30 19 9 8 12 9 10 10 10 8 9 16