S03036-01_G09
Seqid S03036-01_G09
Sequence >S03036-01_G09.phd
NNNNNNNNNNNNNNNNNNGNNNCNNNAANNNGGCGATTGNGNGGCCTATCGGCCGAATTA
CTATGGCTATTGCTAAAAAAAAANNAAAANAAAAAAAAAAANATNNAAANGGNAAAAGGN
NGAAAAGGTACCGGCCATAAGGGCCACCTTGAGTATTCTAAAGTGTCACCTAAATAGCTT
GGCGTAATCATGGTCATAGCTGTTTCCTGGGTGAAATTGTTATCCGCTCACAATTCCACA
CAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACT
CACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCT
GCATTAAGGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCCCTCTTCCGC
TTCCTCGCTCACTGACTGGGTGCGGTGGGTCGTTCGGCTGGGGNNAGNTGTTTCCGCCNA
GTGAAAGGGGGAAGGGGGTTATCCAAAAATTNAGTGGNTAACGTAAAAAAAANNAAANAN
GNAAAGGGNGNNTANAAGGNTTNGAAGTTTAAAAANGNCANAAANNNCCCNATNNTAACC
CCCTGGCNNGNAAGGGANGGAGGAAAAATTANATTTTTTTTNTATACTACGAAAAAAAAA
AAGAGNAAGNAGGGGCCATTGNNTTTTCGAGGGGAGATTAAAANANAAACAAATAACNNA
NACNNNGGTNTAANNGGGGNGNGGATGNNTTATGATTTTTTTTTTTTTTTTTAAAATAAA
AGAANGAAAANTTTTTNTANNTTAATTAAGNNAGNANAAAAAANAAANACTAAACANNNC
ANNTNNNGNNANATAGTGGAGNAAATAANTATANNNTAGATTTGAAGNNNTTNANCNTCA
GGGATNNN
Quality >S03036-01_G09.phd
5 4 5 2 2 2 3 3 4 4 2 2 3 5 5 5 5
7 8 5 7 6 8 3 3 3 10 10 5 5 6 10 13 11
14 22 17 18 16 5 8 7 13 24 10 11 9 9 25 12 24
23 18 13 13 14 10 23 18 11 9 20 11 31 23 23 15 21
20 34 28 26 10 20 9 9 12 10 8 17 13 8 11 7 7
12 14 11 9 6 13 12 19 13 9 9 11 10 10 10 9 7
8 14 6 6 9 8 8 7 11 10 6 9 8 11 12 9 10
6 7 9 16 24 18 9 8 16 17 11 29 37 35 35 41 31
23 28 42 42 37 44 29 45 45 17 9 21 35 47 39 29 33
31 39 28 28 45 28 27 11 23 19 23 35 13 23 13 28 33
25 53 53 42 53 46 19 21 35 35 39 35 33 18 18 21 42
40 41 40 33 53 38 23 38 23 23 31 34 32 35 42 38 38
38 30 17 18 27 14 23 11 25 30 30 44 34 31 25 34 35
31 31 30 23 20 27 19 27 34 32 36 39 37 38 33 35 32
25 34 14 27 35 24 32 35 42 47 47 53 38 42 53 38 27
30 38 28 19 14 38 38 53 38 25 25 35 24 42 53 37 30
42 41 24 47 57 53 35 24 28 45 33 19 30 31 23 33 27
32 19 25 27 19 35 33 44 35 35 38 33 40 19 17 27 31
23 19 33 37 35 25 25 42 41 42 18 16 23 35 42 42 30
35 42 46 46 44 24 24 38 53 44 35 35 35 38 42 37 27
27 25 30 46 46 27 27 27 38 27 38 14 14 33 27 28 24
23 13 14 19 13 14 27 23 27 14 9 19 27 42 35 38 40
38 38 38 53 53 38 28 25 24 19 38 42 32 17 15 11 28
29 20 28 14 18 42 53 35 32 18 11 18 20 20 24 42 38
28 9 10 14 23 17 21 27 27 19 14 13 19 27 27 27 19
20 13 12 27 19 14 11 24 38 23 18 14 8 13 11 19 23
14 14 10 9 10 32 42 12 18 34 33 28 21 13 25 25 40
14 10 12 11 6 6 14 14 6 10 10 9 9 19 11 8 9
13 11 7 9 11 9 9 11 10 10 12 21 19 23 16 9 11
9 9 10 10 16 10 9 19 13 14 16 11 19 19 11 13 10
9 6 9 11 10 12 10 6 14 11 11 13 11 9 12 12 18
37 30 31 46 10 5 5 9 19 12 6 9 7 8 7 10 11
8 9 9 9 6 11 6 6 11 16 7 8 8 8 9 7 16
9 7 13 12 40 8 10 11 9 15 31 37 27 14 6 19 6
10 10 7 8 10 10 7 6 7 11 14 10 6 8 11 6 6
8 9 8 8 11 11 13 9 9 10 9 11 6 6 9 6 11
9 13 13 11 10 6 11 9 9 11 12 9 12 23 19 34 13
11 10 6 11 19 18 29 20 12 18 9 13 6 9 8 9 8
9 13 18 11 9 15 27 41 23 20 12 9 22 24 11 17 9
9 10 7 22 13 10 7 11 13 19 11 9 12 13 8 9 11
9 6 6 8 9 11 13 10 9 9 20 10 11 8 10 15 21
11 12 19 17 14 11 6 11 6 8 23 15 11 13 9 16 9
8 11 14 6 6 10 7 9 9 6 6 6 11 11 9 6 9
10 11 6 6 13 15 10 9 6 10 7 15 13 8 9 9 6
6 11 9 9 9 10 9 14 14 14 14 9 11 9 9 18 19
29 23 11 11 8 14 11 9 13 9 14 9 21 16 22 16 9
20 9 6 12 20 9 16 9 6 11 9 9 11 9 6 11 9
6 6 11 9 10 9 9 9 8 8 10 7 6 17 12 5 8
6 9 9 11 19 31 22 6 9 17 10 7 32 9 8 10 9
9 13 9 6 7 7 9 10 6 7 9 7 6 7 9 6 6
9 7 9 8 8 19 9 8 11 9 9 7 9 10 13 9 13
10 6 8 19 13 11 6 7 6 9 9 8 13 11 16 11 11
9 15 10 6 7 6 9 11 6 14 6 9 6 8 10 18 11
10 9 11 13 6 7 6