S03036-01_G10
Seqid S03036-01_G10
Sequence >S03036-01_G10.phd
NNNNNNNNNNNNNNNTNANNNNNNNNAAANNNGGNGATTGGCGGCCAAATCGGCCGAATT
TGGACAGTTAATGTTTTGAGATACTCTGCGTTGGGTTTGGGGCTATTTTTTGGTTTTAGA
AATGATATGATTTTGAAGTGTAATGCTAAGAAGAAAGAGGAGCAGGCACAGTACGAGGAG
AAATTGAAGCTGGTAGAGGAGGCAAAGAAGGAATACGCCAAGCTACACCCTGTAGTAACT
CCTAAAGATGTGCCTGCGAACGCCTCATTTAATTTGGAAGATCCTAATATAGATTTTGAA
AGAGTTATTCTTAACGCCGTTGAATCCCTGAAGGNAGCTTCAACATAAATAGGATACTAA
AAATGCACATTAGCTCGCAATGAATGACGAAGTTATGATGGATTCTCGTTCGCTAGATGT
TCCCTATTTTTTTNTGCATTNGTTAGTACACAAACAATAAANAAGAAATGAAGTGCATTG
GTCCCNGCNCAAAAAANGAAANNAANTTANTTATATNTNNTAATNTANNTTACTNCACTA
GCGACCAGCCGTGNGGGANANGANNTTNGACAGGNTTTATNNAAAATGTCNGANNAAGGN
CCACAAACANNCCNGGAANNAGNANCNNCTTNNTNGNAGGAAGTTAAANTTGAGGGANGN
AAAATNGGCAGCGTCGCGTAGCTANCGNNGANCCNTGANAAATNANATAGNNNCGGCAAT
GCGGTGAGNGCAGCCACNANGGAGAGGTGGGTGTGNGAAACGGNGAGANGGTCTGTANAC
NAGAGATGGNGGATNANAGNNNNCAAGGAANNNANNGNTAAGGNNCNTAAACNGAGGGCC
ANNGGNAACAATCGNGTNACNCTGGTAGTTGNNANNCAGTATNNAAAGTANNCACTTCGG
GACTANGGCTATN
Quality >S03036-01_G10.phd
5 5 4 3 2 2 3 5 5 5 6 6 5 5 5 10 6
9 7 5 5 5 5 5 6 5 8 9 15 6 7 5 14 9
6 18 24 16 29 31 11 12 14 17 14 18 13 14 14 36 33
40 25 31 35 33 26 18 29 37 29 26 25 15 25 23 34 15
17 14 15 28 35 30 28 26 30 38 41 46 33 14 28 29 21
32 26 27 32 35 32 28 31 32 36 33 27 25 26 26 20 27
29 34 37 33 41 42 42 42 42 49 44 31 44 44 38 28 44
46 42 38 44 49 44 50 42 44 46 42 44 46 43 46 43 44
44 42 46 49 42 39 35 38 44 34 34 28 35 28 44 42 42
50 50 54 50 49 44 47 51 54 54 50 47 51 46 44 50 42
50 44 42 42 46 50 50 49 44 45 44 46 44 42 49 49 47
45 44 50 51 53 43 46 49 50 50 44 49 45 24 42 50 45
34 43 44 54 44 30 22 20 43 39 42 44 33 42 39 27 38
43 49 50 50 57 34 54 49 43 46 44 28 33 35 30 39 33
33 35 33 38 35 42 40 40 60 47 47 49 47 44 47 60 49
60 47 20 33 33 40 42 50 50 40 38 40 42 60 47 47 46
35 43 44 47 44 49 58 35 44 22 32 33 28 44 49 47 54
54 42 32 33 28 43 38 35 33 60 40 47 42 47 21 33 38
31 47 47 47 34 34 34 42 40 35 27 43 35 29 42 31 37
42 30 42 42 35 29 42 52 26 21 15 7 15 35 31 29 27
15 14 30 27 9 19 11 13 10 22 10 13 19 19 17 17 30
20 17 19 19 22 18 18 29 10 11 12 26 22 18 24 30 47
35 42 37 32 32 31 45 32 26 28 19 12 11 13 10 18 27
9 11 9 8 14 13 21 23 35 29 14 26 53 53 19 18 17
18 13 23 11 31 26 21 33 41 25 32 34 14 12 14 9 12
14 27 35 28 37 24 13 16 7 9 13 10 10 16 18 6 9
11 15 19 13 13 14 18 14 17 9 19 16 17 14 11 11 9
11 9 7 9 12 10 10 8 9 9 14 12 9 9 9 15 10
11 14 12 16 11 17 13 11 8 6 10 10 6 8 16 10 16
8 14 15 6 10 14 10 14 6 6 11 8 6 9 23 11 6
14 11 8 9 10 8 6 11 6 6 10 13 14 9 7 9 12
6 6 10 12 10 14 9 6 11 12 11 10 11 10 10 10 11
9 11 14 11 12 11 9 9 11 6 8 9 9 11 6 10 6
11 9 6 6 9 8 6 11 9 10 14 19 11 6 9 19 11
8 18 6 6 9 10 9 11 10 9 11 9 6 8 9 6 6
9 11 9 8 6 10 11 11 11 9 11 10 9 11 6 6 11
9 7 14 15 11 10 6 6 9 10 6 10 6 9 6 6 10
9 9 6 7 9 6 9 7 9 8 9 8 8 10 14 18 10
14 9 6 8 10 9 17 9 13 11 8 6 11 7 12 13 9
11 10 6 9 9 11 11 9 8 11 10 9 9 11 9 8 8
9 8 8 11 7 9 10 6 6 8 9 6 8 11 7 10 11
8 6 9 14 11 9 6 9 6 9 8 11 8 7 6 6 9
9 9 10 11 11 11 11 11 11 10 8 10 10 8 5 8 9
8 10 9 8 9 8 6 8 7 9 8 10 11 9 9 12 9
9 8 9 11 9 14 10 6 9 9 9 9 11 8 11 6 11
10 8 9 6 9 8 10 9 13 10 8 9 6 14 11 6 11
9 10 10 9 11 11 9 6 9 10 10 10 6 11 6 10 11
6 6 6 6 14 9 11 8 9 9 10 6 6 6 11 6 6
9 6 8 9 14 9 14 6 6 9 6 11 11 11 9 9 7
11 14 11 9 9 10 8 10 6 6 9 9 6 9 11 10 9
14 8 9 10 6 9 8 6 9 11 6 8 11 9 9 9 9
11 11 8 11 7 6 9 6 7 11 9 9 9 10 9 6 6
9 16 19 14 10 11 6 6 9 9 11 11 9 10 9 9 9
10 9 10 11 6 14 10 9 10 10 10 6