S03036-01_G11
Seqid S03036-01_G11
Sequence >S03036-01_G11.phd
NNNNNNNNTNNTNNGNNNNCNANNANTANGNCGATTGNGCGGCCNNTCGGCCGANTTGAG
TANNAGANTGTGTGAAGAGAATGTTCATGTTAGTGAAGATGTTGCTGGCAGTCACGGTTC
TTTTACGAATGCCAGACCTAGGTTAATTGTACTAATAAGGCATGGGGAAAGCGAATCAAA
TAAAAACAAGGAGGTCAATGGTTATATTCCTAACCATCTGATTTCTTTGACGAAAACAGG
TCAAATCCAAGCTAGACAAGCTGGTATTGACTTATTACGTGTTTTAAACGTAGACGATCA
CAACTTGGTGGAGGATTTGGCTAAGAAGTATATTAAAGATGAAAGTAGCAGGAGAACTTT
ACCGCTGAAGGACTATACCAGGCTGAGTAGAGAAAAAGACACAAACATAGTTTTTTACCC
ATCACCCTATANAAGAGCGAGGGAAANGTTGAAAGGTATTTTGGTTGACNCCCCCCACTN
CNACNAATGGGGGGGGGNGCCCCAATGTGTTTATTTNTTANATNNNACCNACAANAAAAA
GAAAAAAGATGCNGNTAAAGATTAGTCATGGGGACAAAAGACACGCCNNACCNGCACCCC
GCACGCNAGNANNGGGAGNNAAANCAACAAAATTNTNTATACTTGAACCAACACCAAAAA
NNAGAGGAANAGNAAAAGNNCTTTATTTTGTTGAAAAATTTNGAAGGGAACTNACAACAC
CCCTCCCCCCACCNGACCCNAAGGNGAANGNANAGAANAGATATTNAGTCGGNGAATNNT
TTNTCTAAAATAACAAAAAAACTAATNCGGGAGAAAAATATACAAANGTTGGNTAGANNA
NTAACTNTCAAAGAAGCCAACCACAANNGGGGNAANGGGTCAAGNAAANCGGAATTGAAA
TAGANNAGGGNAAAGCGNCCAAGTCAACTANTANNNAANC
Quality >S03036-01_G11.phd
3 2 4 4 2 2 3 3 13 4 4 10 5 5 8 5 5
7 5 11 5 9 3 3 8 6 8 13 7 8 7 8 19 16
16 10 10 5 9 13 17 19 11 10 5 5 26 26 18 22 29
17 13 10 7 15 17 10 8 9 10 9 5 7 25 26 19 7
22 19 34 31 31 31 32 29 32 43 25 25 27 16 42 26 15
35 11 42 54 46 35 32 22 32 28 11 11 11 19 22 38 32
27 38 31 35 32 28 22 12 25 44 42 44 44 54 60 60 35
32 35 60 60 42 44 42 30 35 22 47 57 47 36 32 57 48
42 60 52 52 52 63 63 52 52 53 52 63 63 57 43 52 52
48 63 57 57 63 58 53 48 48 53 63 57 60 53 53 48 60
57 52 42 48 43 43 40 35 29 48 57 52 57 57 57 57 57
52 57 48 53 48 34 58 60 60 43 53 53 53 53 53 48 48
48 60 52 45 43 43 45 52 57 48 53 53 60 53 53 53 52
52 60 53 53 53 60 60 60 53 37 47 44 29 27 44 43 31
53 43 53 57 53 43 39 53 53 41 43 53 53 53 52 53 53
53 53 53 60 60 57 57 63 53 53 53 53 53 60 52 52 60
53 53 53 53 53 52 53 60 63 60 43 43 53 57 52 60 53
53 53 53 52 53 53 57 63 43 53 57 57 52 60 53 43 43
53 53 53 53 53 53 53 53 48 26 43 43 43 53 52 52 52
63 53 63 53 53 57 52 53 57 52 52 53 35 44 35 53 37
32 44 47 35 21 35 34 23 35 18 18 29 29 34 35 19 22
27 34 27 19 19 18 26 45 53 53 52 57 53 53 43 32 57
52 57 45 52 53 53 27 37 37 35 21 16 11 35 23 19 53
28 48 52 53 53 18 9 35 47 53 39 37 37 24 32 18 34
42 21 27 23 38 23 24 19 19 37 13 29 9 27 29 10 29
35 27 17 10 21 19 6 24 16 24 22 18 13 11 9 26 46
23 20 16 11 6 9 14 35 29 34 27 42 29 32 22 11 22
14 18 19 23 14 13 11 9 11 13 7 11 20 21 24 14 14
18 17 10 7 9 7 9 11 6 10 11 9 11 11 9 11 23
12 12 11 10 5 16 9 12 18 9 10 9 19 11 9 11 11
8 8 12 16 10 11 6 9 9 11 6 8 9 6 6 6 16
10 9 6 18 8 9 9 7 16 19 24 17 32 9 28 19 24
20 19 14 9 11 11 20 11 6 11 6 10 27 10 23 14 11
9 9 9 10 10 10 11 10 10 12 10 9 8 10 8 12 10
13 10 16 11 8 9 10 10 10 6 6 10 14 9 6 8 9
9 9 11 23 9 9 9 10 9 9 9 6 9 14 6 9 6
7 9 16 14 11 11 7 6 11 14 10 6 11 9 11 11 10
12 14 10 9 14 6 9 6 9 9 12 8 8 14 16 10 15
10 12 14 12 10 9 23 11 14 13 18 9 14 18 6 7 11
9 11 17 22 10 9 7 14 9 7 11 9 10 11 11 6 6
11 10 10 10 9 14 12 25 11 10 15 14 11 13 16 10 14
10 10 10 28 6 11 9 9 9 11 9 9 28 19 9 6 9
16 12 11 9 10 11 9 9 10 8 16 13 14 14 14 12 11
9 14 6 9 9 11 22 14 7 9 9 9 11 7 11 8 8
6 22 6 10 6 9 11 8 9 6 8 12 12 9 9 10 14
6 10 11 11 11 11 10 6 8 8 11 10 6 6 9 13 19
6 12 9 10 10 19 13 18 14 19 13 11 9 16 16 19 23
29 17 16 9 9 12 9 7 11 9 11 19 28 9 11 17 18
10 9 8 9 13 28 9 24 27 28 6 8 14 11 9 12 6
14 9 10 34 6 6 16 7 9 22 14 10 11 6 9 19 10
9 18 8 10 14 8 11 11 8 14 9 14 10 9 8 14 6
6 14 14 9 13 6 8 8 6 9 9 9 9 9 13 20 10
6 13 16 9 6 9 10 9 11 9 9 10 11 11 14 11 10
14 11 12 6 6 13 10 13 18 7 11 11 9 8 10 19 6
10 15 16 9 10 8 11 10 11 11 11 9 6 10 8 6 6
7 10 14 6 8