S03036-01_G14
Seqid S03036-01_G14
Sequence >S03036-01_G14.phd
CNNNNNNNNNNANNNNNNNNNNNNNNNNNNNNNNNNTNTTTNNNGNNNNNNAAAANNNCN
TNNCNNNNNNNNNNNNNNNNNGGGGGGNNNNNTTNNNTCTTCTTNCTCCCNNCCCAAAAA
ANGNNCGGCNTNTTTTTTTNNTNTTTNTTNAAAANNAANNNNAAAAAAAANCCCCCCCCC
CCCCCGAGGGGGNNNNNGGNGNNNNTTTTTNTTTTTTTTCCTNANAAAANNNNAAAAAGG
GGGNNTATTTNTATNNTTTTTNGGGAANNNNAGGNAAGAAGCCANCCTNCCCCCCCAGNN
ANANNNNNGGGGGGGGGGCTNATTTTCTANTTAAATAGATATTTCCNACNAACAGTCANA
TTTGGGGNCAGGCTNGACGGNTNTTNAGNNGGNGTCTGTCTCCNAANNCCCCAAACNNGG
GNNNGGGGGGGCTNAGAAAAANATTCAANAATTTTTTNNTTTTTTTCNNNTTTNNNNATT
GTGACTTATCAGTATTTATTATAAAAAAACANGGAANNANAAATGNAAAANANNNAAAAN
CTCCTCAGGNTGCTANAAANNACGGAGGAGTAGAANTGGGAGGAAANAANTAAANAAAAN
ANANNGTAAAATATNAACANCCGCANAATTGNAGANGGCCGGGCANNAGAGATCAANTAA
CCAGCCAAGGNAATCAGNCCATANNAAANGATTTNGAGAAGNCATGAAGTAGCAGAAATT
AAAAGATCTTGGGAACCAGACGTTGACGAAGCCCTGANACCACCCTCGGCGAGAACCGCT
GAACAAGTTCCAA
Quality >S03036-01_G14.phd
10 5 5 4 6 4 6 2 3 2 2 11 3 4 3 2 3
3 3 3 6 4 3 2 3 3 3 2 3 5 5 2 5 7
7 5 11 2 11 9 8 6 7 7 15 4 5 5 5 6 4
19 18 12 15 5 4 4 16 5 14 5 5 8 6 7 5 5
7 6 3 4 7 7 7 6 6 6 6 5 6 9 10 8 11
13 8 7 7 6 6 7 8 23 7 6 6 8 8 8 10 11
10 8 7 9 8 10 9 11 7 7 10 11 11 11 14 19 17
15 10 7 12 7 6 8 14 11 10 6 8 6 12 25 24 28
21 14 13 7 6 10 6 13 16 9 6 13 12 6 9 8 8
8 7 5 12 15 3 3 3 6 21 17 16 16 19 15 10 8
7 8 12 9 14 12 14 16 9 13 10 10 10 17 11 14 10
16 13 13 10 9 5 7 5 5 5 33 16 5 10 7 3 5
6 13 12 16 26 13 6 10 18 22 15 12 10 12 9 9 8
8 6 9 6 9 22 17 10 5 5 6 6 11 19 13 9 10
18 14 12 19 12 7 6 10 13 14 13 12 6 9 14 8 5
6 12 11 15 16 13 7 9 25 13 13 11 5 5 5 3 10
9 11 5 14 13 11 13 17 11 10 11 9 6 9 13 10 6
12 19 14 10 9 14 15 12 11 6 6 9 7 12 6 3 3
7 7 13 14 17 27 14 14 16 10 10 21 9 9 6 9 10
10 21 18 10 11 11 7 10 17 12 14 13 9 16 12 12 14
17 14 17 13 9 12 7 10 11 7 15 11 12 8 10 10 14
13 7 13 13 14 12 13 10 13 15 6 12 11 11 11 12 10
6 15 20 13 11 9 6 12 6 9 12 6 9 12 7 6 9
9 7 13 12 9 9 10 10 9 9 10 10 7 9 9 6 6
9 12 10 10 11 14 11 10 6 6 11 9 9 6 6 7 11
11 10 10 15 16 17 12 13 7 12 16 19 15 11 12 8 7
11 10 11 11 9 25 7 9 9 13 19 15 17 15 15 6 6
9 9 9 12 17 15 22 9 6 6 6 11 10 9 6 6 6
7 13 13 11 10 13 10 16 12 12 10 10 9 9 10 10 9
10 9 12 11 16 11 11 10 13 18 16 11 17 26 19 11 9
9 7 12 10 19 16 7 6 12 6 11 10 10 10 9 7 12
18 10 16 7 16 6 6 7 11 11 14 17 6 9 11 11 13
12 12 8 10 9 7 10 13 8 14 15 6 21 20 13 6 7
14 13 8 18 19 15 11 13 26 10 12 17 16 15 6 10 12
12 8 15 12 11 15 16 18 6 9 15 7 10 14 13 19 7
16 11 9 11 6 11 7 9 6 6 9 12 19 16 14 18 8
19 11 7 11 13 14 18 6 12 8 19 18 11 7 14 16 8
8 11 7 10 10 8 7 10 8 16 8 8 13 13 12 15 7
7 13 16 14 14 16 13 9 12 13 7 18 12 8 15 15 13
10 9 10 11 13 8 8 7 10 11 10 12 13 11 6 8 8
9 10 10 6 7 12 17 11 7 11 11 10 10 8 7 9 11
9 16 14 11 7 10 15 13 11 16 10 16 14 14 13 9 11
11 17 17 12 19 12 11 11 9 9 9 13 8 9 23 10 8
9 8 14 10 11 12 9 10 9 11 13 10 11 8 16 11 12
9 10 14 9 11 10 11 12 8 6 10 11 13 13 16 9 11
10 9 11 13 11 8 12 8 22 20 12 10 11 11 14 11 15
16 14 14 12 10 10 11 11 14 16 16