S03036-01_G16
Seqid S03036-01_G16
Sequence >S03036-01_G16.phd
NNNTTTTNNNNNNNGGNCNNAANAAANNANNATTGGCGGGNNTCGGCCGAATTGAAAAAC
AGAGCAGTGGACAAACCAGGATTGAAGTCAGCGAGGGTGAAGAAACCATGAACAATATAT
TTCATGGAACTGAAGATGAATGTGCTAATGAAGACGTTCTTAGTTTCCAAAAAATTTCCT
TGAAAAGTCCCTTTGGTAAGAAGAAGAACATATTTAGAAATGTTCAGACCTTCTTTAAGT
CAAAAAGCAAACATTCGAATGTCGACGATGATTTAATCAATAAAGATAATCTTGCCTTTG
ATAAATCTCCATTGTTAACAAATCACAGGAGTAAGGAAATTGATGGTCCTTCACCGAATA
TAAAGCAGCTTGGCCATCGCGATGAGTTANATGAAAATGAAAATGAAAAATGATGATATA
GTCTTAANCATGCATTTTGCTGCTGAGCATTACAAAATCCAAACAGAACCTCCTCCCAGA
AGGGCTTTGNGGGAGGGGAGGAATTGTGATCGATTATNNTNCGTACATANNCAANAGTNN
GGNANAAGGGAAGGGAGCAGCNNCGTCGGGGCANAANGGAGAGAGAAAAAANCNTNNTCG
GTCTTCTTTGGGNGGNNNGAGGGGANAATTTTTTTTGAATTTTATTTTAAAATATAAGNA
TAAGATANAACCGAGCCNGCGNNGGATGGGATGGATTTAGGGGAGNGAATGGCACCCCCC
CCCGCNNNNNCGATNAAAGAGANNTGAAAGGGGGGGTTTTGNTNCATGTTTTTNTTTTTC
TNAAAGAGTNNNANAGCAACNAGNNNAGNANAANTGCGGGNNCTGGNAGANNCAGTGTGN
GAGGCAGAATGAAATATGAGGGAAAATGGCAN
Quality >S03036-01_G16.phd
5 6 6 11 10 9 8 5 3 6 6 5 3 6 11 26 5
8 5 5 10 10 7 12 17 10 7 6 8 3 5 8 9 10
23 14 10 27 16 10 5 7 16 18 28 27 21 19 19 30 11
31 21 12 11 15 15 11 13 18 19 31 44 27 35 35 11 17
32 32 30 12 47 47 46 46 32 28 41 60 10 11 13 10 9
12 23 36 41 16 22 39 24 27 31 35 35 41 42 29 26 27
26 16 17 27 24 9 23 37 28 27 24 19 42 40 42 53 47
53 60 57 52 32 60 57 53 52 60 52 57 63 52 57 53 52
52 57 52 53 52 52 52 52 52 52 53 53 53 57 57 53 57
52 52 57 57 52 57 60 52 57 57 60 60 52 57 52 53 57
57 57 57 57 52 57 57 57 60 60 52 53 52 60 57 57 57
57 57 60 57 60 60 52 52 57 52 57 53 53 53 57 57 52
53 53 57 53 53 47 53 53 57 60 52 52 57 57 53 47 52
52 46 53 53 35 34 37 35 35 35 53 47 42 35 21 23 18
34 52 53 35 39 53 53 53 57 60 60 53 53 57 53 53 57
53 60 53 57 53 58 57 57 57 52 53 53 52 52 60 52 45
63 52 53 57 60 57 53 57 52 60 53 53 53 52 53 41 35
44 57 52 60 48 44 59 57 48 53 43 48 45 39 35 43 43
48 45 32 22 18 44 48 48 30 29 29 28 28 37 53 43 43
36 44 43 43 43 43 22 22 52 47 45 32 43 39 53 47 47
32 29 17 30 44 34 20 44 48 43 30 20 9 14 35 44 29
30 30 28 20 11 15 28 39 42 39 42 60 60 52 57 23 23
36 26 53 42 41 39 11 14 23 13 53 31 45 31 13 6 21
39 35 30 26 11 9 13 31 33 18 9 9 15 14 25 23 11
11 13 9 21 25 16 20 9 10 11 9 15 16 10 16 23 14
9 11 6 9 9 20 11 10 24 45 35 11 14 23 13 10 9
11 9 9 9 9 9 10 13 13 27 16 19 19 11 13 10 10
18 19 15 11 9 9 9 16 14 12 20 12 11 9 11 16 18
18 14 24 35 23 18 10 9 10 17 12 9 11 6 9 12 16
9 13 13 10 10 17 28 19 18 15 9 9 9 9 9 24 9
9 11 9 9 11 9 9 6 7 9 6 10 9 11 9 9 10
12 11 6 6 14 11 14 6 8 11 9 6 6 12 18 7 8
7 9 9 13 14 10 11 9 11 14 10 8 10 10 9 11 9
6 6 10 10 11 10 13 12 9 11 12 9 7 13 12 7 11
11 13 11 11 8 9 11 19 14 13 9 10 11 6 13 6 9
6 6 9 10 10 14 9 9 9 15 10 9 9 11 10 12 11
6 8 12 6 6 7 9 9 13 30 24 10 10 6 11 9 9
9 11 10 9 14 17 9 10 9 9 23 14 10 10 8 9 12
11 9 16 11 19 14 11 10 8 16 13 9 6 8 8 13 10
10 14 11 10 6 9 14 9 9 9 14 14 11 9 6 9 14
8 7 6 10 9 10 9 11 11 13 9 9 13 11 11 12 9
9 9 18 40 18 19 9 10 6 9 11 10 8 11 14 9 10
9 9 9 9 10 9 14 19 12 11 8 6 6 6 6 6 12
9 12 10 6 9 9 14 9 8 10 9 6 6 9 9 8 8
10 9 10 16 13 9 26 18 10 9 8 9 9 6 10 7 10
8 9 9 12 12 22 13 8 6 11 10 12 9 10 9 11 6
9 11 9 10 11 8 11 6 6 6 10 6 11 11 9 9 9
11 7 10 9 6 6 6 9 8 6 11 6 14 10 6 9 8
9 14 19 9 6 6 9 9 10 9 6 8 11 11 6 6 10
13 13 10 8 11 9 7 19 8 8 10 10 14 10 9 11 9
9 9 9 8 10 10 9 13 9 13 11 9 11 10 9 9 9
10 13 9 9 6