S03036-01_A17
Seqid S03036-01_A17
Sequence >S03036-01_A17.phd
NNNNTNNNNNTNNNGNGCNNNNNNNNNNNNNNGATTGNNGGNNNTCGGCCGANTTGGAAG
ATTAGAATTTTTTTCATACTTTNNNCNAACATTTTTTTGTACTTAGGCACGCTAATTGCG
TAAAAATTAGCATAAACAGGAAATAAGATTATTTTGAAATATAACAAGCACAATGCTTTC
ACTACGTCAATCTATAAGATTTTTCAAGCCAGCCACAAGAACTTTGTGTAGCTCTAGATA
TCTGCTTCAGCAAAAACCCGTGGTGAAAACTGCCCAAAACTTAGCAGAAGTTAATGGTCC
AGAAACTTTGATTGGTCCTGGTGCTAAAGAGGGTACCGTTCCAACAGACCTAGATCAAGA
AACTGGTTTAGCTAGGTTAGAATTATTGGGTAAATTAGAGGGTATCGATGTTTTCGGGGG
CAANCCATTTGATNCGAGCAGGAANGAAAANNGNAAAAGANNCGGGNCAAGCCCGATGGG
AAGTTNGTGGNAGGGAAGAATATGTTTNGTAATGTTATTTGNTTCNTAGAANAAGAAGGA
AAGAAAGAGTCCTCACNCNCGNTAAAAATAANGNGNAGAANAAGAANNACAGTCCCNNTT
NNNCCCCAAANAGGGAAAANGGGANNGAGTATNNGCNTNTTTTNTCTTCAAAAAACNCAN
AACGAAAAAGGGAAGTTACCTGNTTNTNTTTCGAAAANAGAAACANANCCCANCGANCCC
GCNNNGCNANAAGAGNGAAGANAANNNGGAAANATTGNATAANNTATANNTNTCNNNATN
AAGAAAACATGGNATTNNNCATNCNTGNAGNGANAGAAGNNAGTACTTCNCTCCNCTNNC
GNCGCCGAGAGNNNGNGNAGGANGNANGNTTNN
Quality >S03036-01_A17.phd
5 4 5 6 10 4 3 3 3 6 8 5 5 5 8 5 10
10 5 7 5 3 3 6 5 6 5 7 5 3 6 5 17 12
9 12 24 7 7 21 8 7 5 5 12 17 30 23 16 26 21
15 5 21 36 13 10 12 13 19 31 8 10 19 16 24 18 23
28 21 19 27 21 28 21 26 27 37 35 32 35 19 7 5 6
8 6 11 27 32 13 21 18 17 15 17 29 26 16 9 16 14
16 12 12 27 44 16 16 14 22 28 26 28 29 25 40 40 24
43 21 23 29 41 29 16 34 43 32 33 42 47 57 34 32 35
52 40 48 57 52 60 52 41 48 48 52 52 40 58 48 48 48
60 60 53 26 34 40 52 57 60 57 60 52 42 57 60 48 45
60 45 44 45 53 43 53 53 53 52 52 52 48 43 53 41 53
53 52 53 63 63 52 57 57 48 43 41 63 53 60 60 60 53
43 35 53 60 53 43 37 57 53 53 53 53 42 53 57 53 53
53 53 60 53 53 53 53 27 27 31 21 23 27 19 19 27 37
35 35 53 53 53 53 53 53 35 43 53 53 52 60 60 57 60
57 57 57 53 53 53 35 53 53 53 53 53 53 53 43 53 53
53 53 53 60 53 53 43 43 53 53 53 53 53 53 53 53 53
53 57 57 53 53 37 53 37 28 44 37 30 38 53 39 30 39
44 39 39 39 25 25 35 53 53 47 53 44 38 53 53 36 53
45 53 53 60 57 53 57 53 53 43 44 25 28 35 53 53 37
53 35 34 25 28 10 31 29 37 30 31 28 23 18 18 14 27
23 27 21 20 25 25 31 53 53 21 35 35 53 53 60 53 30
37 53 53 33 31 33 53 53 35 35 19 42 25 14 11 17 19
18 19 12 28 34 27 13 24 12 21 27 19 23 13 22 19 25
13 29 26 16 19 11 16 10 9 9 11 11 12 12 10 6 12
13 20 23 20 10 18 10 9 6 12 16 9 13 13 18 18 20
33 19 7 12 10 10 11 9 6 7 9 6 9 33 24 22 9
9 6 6 9 11 12 9 6 9 11 10 13 13 15 9 9 8
10 9 10 9 11 10 9 10 8 7 9 8 10 11 6 8 14
11 9 11 9 9 9 9 11 23 9 11 13 22 14 6 9 10
11 8 9 11 19 11 10 9 9 18 10 6 9 12 11 6 11
23 11 14 19 6 9 14 10 9 10 9 10 9 10 15 10 10
10 12 11 11 11 9 9 19 9 10 9 10 6 9 6 8 10
6 14 11 14 10 21 9 9 12 11 6 11 6 9 6 10 9
20 16 6 11 18 9 18 11 7 6 9 9 11 9 9 12 17
16 6 7 9 9 6 6 6 9 10 9 9 16 9 9 7 24
9 14 10 9 11 11 9 7 10 8 9 12 7 6 8 14 9
11 11 9 6 7 9 9 6 12 6 12 10 11 20 6 12 9
9 10 8 12 19 19 14 16 12 12 6 10 12 6 9 10 9
9 20 8 12 8 9 14 10 9 9 10 11 9 10 10 9 10
10 9 6 13 9 7 9 6 9 10 24 22 10 14 18 10 12
6 12 9 10 10 14 11 8 7 11 7 14 9 9 9 6 9
8 9 7 12 19 16 10 11 6 6 7 8 10 7 9 7 10
9 11 11 8 7 10 8 11 9 10 6 10 10 5 7 7 18
12 9 8 9 6 8 23 9 8 6 10 9 9 9 6 7 9
12 15 11 6 7 9 7 9 8 6 7 7 9 8 6 9 22
12 17 16 20 14 9 29 16 10 9 6 11 9 9 6 6 6
9 14 11 7 9 5 10 9 6 12 9 6 8 8 5 8 9
8 11 9 7 6 12 9 9 9 12 11 8 9 6 13 9 12
18 6 9 9 6 6 16 11 7 9 22 9 12 11 8 17 9
9 6 6 6 18 7 11 6 9 34 11 9 7 9 6 10 6
9 6 8 10 6 6