S03036-01_G23
Seqid S03036-01_G23
Sequence >S03036-01_G23.phd
NNNNNNNNNNNNNNNNNNNNNCNANNANANGGCGATTGGCGGCCAAATCGGCCGAATTGG
ACTAAAAAACGATATTAAAATGTGGAAGGCCGTGATGAATGCTTGGAATGGAACCGAGAG
TCAAAGTAAGAATGTTTCAAATATTCAATCTTACAGTTTTGAAGACATGAAAAGAATCGT
TGGAAAGCATGATCCTAATGTGGTTTTGGTAGATGTTAGAGAACCATCTGAATACTCGAT
TGTTCATATTCCTGCTTCCATCAATGTGCCATATAGATCGCATCCCGACGCGTTTGCCTT
AGATTTTTTAGAATTTGAGAAACAGATTGGCATCCCAAAACCTGACAGTGCCAAGGAGCT
AATATTTTATTGTGCTTCTGGCAAACGCGGGGGAGAAGCTCAAAAAGTCGCCTCCTCACA
TGGATATTCAAACACCTCACTATATCCTGGCTCTATGAATGATTGGGTTTCTCATGGGGG
TGATAAACTTGACTTATAGCCTTGTATACTCTAGGTATGTACCCTGTGTATTTTCGTAAG
CTAGTAACGTATTATGCCATTTATGTTGCACCGTTCAAAAAAAAATAATCNNNCCCTNTG
TCGGGAAATGGAAGNGGAGAATGATTTTTNTANNTTNTNTGGCNAAAAGGGGCAACAAGG
GGAACCCAAGGTGTCTTTTANTTNTTTNTNGAAAAGAAGAAANCACTTANNTTCTTGNTG
NNCTGCNNNNNTACNNGGANGGATNNNNGANNNTTTNANTTAAATATAAACCNAGNGGGG
GAGGAGTNTNGNAATTGNTNTTAGGANATAAAACNAGACCCCCCCCCTTCCCNCGANNAA
CNGGGGGGGGGNGNGGTGGGT
Quality >S03036-01_G23.phd
5 4 3 3 3 4 6 2 4 4 5 7 5 5 5 7 6
7 7 5 5 10 7 10 6 5 8 6 8 5 12 28 14 22
17 14 29 31 15 15 41 27 17 23 16 17 21 37 32 30 25
40 30 25 23 12 17 28 17 11 12 13 31 35 41 40 31 28
26 28 18 36 37 38 31 32 42 49 49 49 27 43 37 46 36
27 32 24 30 25 42 40 42 42 30 31 32 23 29 28 43 34
37 36 47 35 28 33 26 42 35 36 38 26 35 35 42 42 42
31 42 43 35 35 49 49 42 35 32 28 35 21 35 50 53 43
41 46 35 35 49 49 54 54 59 42 35 43 49 57 54 51 49
49 42 51 53 53 53 53 51 51 49 46 42 43 46 49 49 45
49 54 54 42 49 43 38 39 35 37 50 50 49 42 46 49 54
59 49 49 53 39 45 51 53 50 57 49 54 57 49 53 47 47
47 43 43 49 50 54 54 54 42 43 54 54 54 54 35 49 43
49 49 50 49 43 54 54 49 49 47 42 40 40 42 46 40 32
34 35 39 49 37 33 36 42 54 49 53 51 51 46 49 49 54
54 50 50 50 50 49 49 54 54 54 57 57 53 53 51 54 57
57 57 57 51 51 49 53 57 54 54 51 53 53 53 57 57 54
49 53 57 54 54 51 57 54 54 53 49 49 50 42 42 51 53
53 53 50 43 49 57 54 50 49 50 50 51 54 57 57 57 50
57 49 42 32 54 50 44 49 46 49 54 51 49 39 46 46 44
44 44 43 41 44 50 54 50 50 50 49 44 42 43 49 57 41
43 42 28 29 34 38 44 49 50 50 50 51 50 59 57 54 57
54 50 53 49 50 50 47 43 42 43 44 46 42 54 54 50 49
51 58 63 27 63 63 44 50 54 54 60 58 63 63 60 44 60
50 44 50 54 50 54 60 49 60 47 60 47 54 54 49 44 47
47 47 43 44 35 47 46 49 44 54 49 49 49 60 50 49 49
54 47 47 60 60 60 57 57 60 57 46 52 52 60 47 52 41
44 47 42 27 29 36 40 35 29 32 32 35 27 40 34 47 57
35 35 57 60 34 28 28 17 17 18 17 22 28 35 35 32 35
34 42 57 47 46 31 42 43 35 43 43 29 18 28 23 22 28
41 30 27 10 18 27 29 42 35 35 21 23 22 17 16 28 12
23 12 16 17 16 13 9 12 9 10 22 21 12 18 14 18 23
19 11 9 10 10 20 18 42 35 16 16 16 16 21 10 9 15
29 18 41 41 18 11 12 25 19 15 47 26 8 12 9 13 33
9 26 21 17 12 10 11 9 10 8 9 9 6 7 6 11 11
12 9 7 9 8 11 8 9 9 12 11 9 9 9 9 11 8
9 11 7 9 9 18 11 11 8 8 9 11 10 9 18 13 9
6 8 9 6 6 12 11 6 12 7 13 8 9 9 6 12 11
12 9 9 13 9 9 12 19 9 9 9 8 9 10 9 10 12
20 11 9 9 12 12 10 15 9 11 9 9 9 8 9 9 11
6 8 13 6 25 16 17 6 9 6 9 12 13 14 18 16 14
9 13 9 20 11 6 8 8 9 10 9 8 6 6 8 9 9
9 9 8 6 10 8 7 6 12 10 9 9 6 7 6 7 6
8 9 8 5 6 12 9 10 6 9 20 9 9 6 6 6 6
8 8 7 7 6 9 17 8 7 9 6 22 9 14 9 9 24
9 10 12 24 13 9 8 6 10 12 6 21 8 9 8 19 11
11 10 13 10 8 7 9 6 9 7 8 9 9 10 9 7 9
6 9 9 10 9 8 10 7 10 10 11 13 27 9 11 7 8
9 8 8 10 13 23 19 16 10 23 11 9 9 13 14 10 7
9 9 9 6 7 8 9 8 6 16 15 18 9 28 10 29 12
11 6 18 6 11 8 11 9 8 8 12