S03036-01_G24
Seqid S03036-01_G24
Sequence >S03036-01_G24.phd
NNNNNNNNNNNNNNNNNNCGNNNNNNNNNNNGGGNGATTGGCGGCCAAATCGGCCGAATT
GCTCCTTCTAAAGTTTTCCTCTTTTCTTATTTCTTTTTCATTTATTATTCATATTTATAT
AAATATATATTCCAAGTGCATGACATTATTGGATACACTTTTTCTGAACCTGAATTACCT
TGGTAGATAATAGGATACAGATCGGGAACGAACAACAATTATAATATTTTTTAATAATGT
TGAGAAATACTTTTTTTAGAAACACCTCGAGGAGGTTTTTGGCTACTGTAAAGCAACCTT
CAATCGGAAGATATACCGGGAAACCTAACCCTTCTACTGGCAAATACACGGTCTCGTTCA
TTGAAGGTGATGGTATCGGACCTGAAATTTCCAAGTCTGTAAAGAAAATCTTTAGTGCAG
CAAAACGTCCCCATAGAATGGGAATCTTGTGATGTTAGCCCTATCTTTGTCAACGGATTT
AACGACCATTCCGGACCGGGGCGTACAATCTATCACAAAAAAATCTGGGTGCACAAAAAG
GTACACTAGCGACACCTATAGGGTAAGGGGAGAGAAATAGTGAAANTGAAAAAAAAAACA
ACCCTGTCGGGTCAATTTAGCAGGGGGGGGTGAGGATGAGGGNATTAANTGTTTTTTCTN
TTTATTTGCAGAAANAGNAGNAACAACAACCAAGTGCAGGCCATCCCGGGTGGGNNANGN
NAAAGAAAAAAGATAAACATCCCGACCGCATACGAGACTGANGAGGGGGTGTGGAAGAGN
GNAAGAAATTNATATTTAGTATTANGTTTTGTAATGATGATGTTNAGGGGGGANGGTGGN
GAGAGGG
Quality >S03036-01_G24.phd
6 4 3 4 2 2 2 3 3 3 3 6 5 5 3 3 3
3 8 8 5 6 7 5 3 7 5 5 3 3 5 9 26 30
7 27 24 15 28 35 16 12 30 27 11 28 9 21 15 41 35
41 31 33 49 35 38 13 29 29 31 19 34 34 32 31 46 46
29 35 35 34 42 40 46 35 35 37 38 46 59 40 43 35 35
30 9 10 15 12 20 42 50 35 42 39 33 33 38 16 36 35
32 36 36 28 27 26 26 24 19 31 31 36 27 17 25 35 33
35 19 29 39 47 44 60 44 44 44 47 47 40 34 31 47 49
47 47 47 39 47 50 44 50 47 50 45 50 51 51 63 49 45
54 49 60 47 50 60 60 47 49 47 54 54 49 50 50 54 54
54 50 44 50 50 44 50 50 50 49 57 45 46 44 46 45 51
50 50 57 54 51 45 43 45 47 54 52 50 44 45 49 43 43
43 46 44 44 44 42 46 42 50 42 46 54 46 43 49 50 54
49 49 49 49 54 54 54 49 46 46 34 42 39 42 28 35 32
46 36 35 42 42 42 43 42 42 49 43 44 46 51 54 51 46
53 44 38 42 49 42 42 46 39 33 43 43 54 44 42 50 57
45 38 57 50 54 49 49 49 57 42 42 50 43 50 54 57 43
54 54 54 54 54 54 50 47 49 50 50 54 42 42 50 50 42
43 50 46 50 42 30 50 50 50 43 49 49 46 53 51 57 54
33 42 46 54 54 42 49 49 50 47 42 42 46 46 54 54 50
38 33 54 54 50 43 50 31 54 42 49 34 54 50 42 50 42
43 43 42 42 43 49 35 43 42 57 30 50 44 39 49 45 42
59 59 43 44 49 44 30 46 43 42 54 59 42 54 54 39 36
39 28 39 50 54 36 44 50 54 27 50 50 54 54 50 42 50
54 39 44 43 43 42 44 42 54 28 42 39 44 19 35 21 39
38 30 36 27 38 39 42 31 42 34 36 39 50 42 42 39 28
39 35 44 33 29 39 34 14 31 31 22 31 22 22 17 12 11
17 31 28 27 31 25 19 14 19 19 22 23 19 22 22 13 19
12 14 17 17 17 13 28 12 12 21 19 21 14 16 22 9 9
19 33 16 10 11 11 24 11 16 33 11 16 12 14 27 16 22
15 11 27 16 25 25 24 18 17 25 15 25 23 11 19 28 27
14 13 11 27 15 12 10 16 28 38 16 17 10 13 10 8 11
17 23 16 25 17 14 11 14 19 11 20 32 22 16 12 9 9
31 17 16 14 9 10 16 11 14 16 10 11 11 10 19 11 15
24 15 16 11 19 19 11 6 9 9 23 16 25 20 21 18 35
14 21 15 15 20 17 16 14 13 15 13 14 12 13 15 10 14
16 13 14 13 17 18 13 9 13 19 10 14 25 20 24 17 14
16 15 12 9 21 25 11 12 11 16 16 8 13 7 14 22 9
16 11 7 12 15 20 32 16 25 11 11 14 13 7 14 8 9
13 14 15 17 15 9 9 11 11 14 13 7 12 11 7 9 11
6 10 13 10 11 12 14 14 17 21 12 10 10 10 8 13 9
11 8 10 10 10 10 10 13 10 11 13 13 14 14 11 11 9
6 6 8 6 9 6 6 14 14 11 10 11 9 9 14 18 19
16 20 11 20 13 27 18 15 8 11 14 37 11 14 15 16 11
12 11 9 11 18 19 9 11 19 13 10 13 12 7 13 9 11
15 15 28 41 11 20 11 22 20 11 11 27 21 14 7 10 6
9 10 10 9 18 19 15 27 7 18 17 20 9 10 11 10 10
31 20 24 19 16 7 10 18 12 11 9 14 18 10 10 9 15
11 9 10 14 9 18 10 10 6 15 8 11 9 14 24 17 35
6 11 19 11 9 11 6 16 15 11 14 14 14 19