S03036-01_H01
Seqid S03036-01_H01
Sequence >S03036-01_H01.phd
GNNNNNNNNNNNNNTNNNNNCNCNNNNGGGCGATTGGCGGCCAATCGGCCGATTGAGCAG
CTAACATTGCTACACATAACTAAAGAACAACACCAAGCCAGTAACTAGCACGAAAGGAAG
GAAAGTAAAGTTTTGTATCCCATTCTCTTTTTTGATTCTTATTGAAATGTTAGGATTATA
TCTATCCTCCCTTTTCTTCGCCTTTTTTATGGCACAAGTGTTTGCTACCAAATACTCAAT
TACTTTTACATCAGATGAGTATGAAGAAGATGAAACAGGACAAAATGAACCTGGTCCTTT
AGTTTTCCATTTGGATAAAAACTCATTACCACCAGCTCTGCTAAATCAAATGGAGTTTAA
TCCATACTTAGTATTAGCAGATTTACCGGAGGAGCCGCGAGCTGTTGATTCTCAAGAACA
TACCGATACGGTTCTTGCTTCCAAATCTGTTATAGATTTTCTGTTGGAAGATCCTCTAAC
AATAGTGGAGCACAAAAAGTTTTCTCAAATTGAAAGTATTCTACATGAAATTATGGAAGA
TAGCATACAGAAGAAAGTCGGGGCAGACGAGGGTATTTGAAGAGATTCCGAAAACGAAAA
ATTACCGCGNTGAAGAGAATGTAGGACGAAANTGAGCATCATCAATTATNGTGAAAATGC
CGACNAGNACTGCAACCTTTTACCAAGAACCAATCCCTATTTTTTNNNNNNGGACAAATT
TTAGATATATNCACAGGTGTTACCCACCNTTTGGAATGTCGCNGAGAGGAGGGCGGGGAA
AAATTAAAAACTTTTTGGGGGGAACGGAAATTCCCCCNCCCGGCGGAAGGGCCGNTAGTA
GGGAAAGTNACGTGTATANAATAGNTGGTACANAGTACGTNACCCCTACAGTTTCGTCGC
GGGGGNAGGNGNNANGTNTNNGNGGA
Quality >S03036-01_H01.phd
8 5 3 2 2 3 2 4 3 5 3 4 3 5 9 3 5
5 7 5 9 5 8 5 5 3 3 9 14 30 8 28 29 17
33 35 18 15 33 24 17 12 30 32 45 33 40 26 31 36 36
23 13 32 34 28 31 34 31 35 36 30 37 37 42 27 41 52
51 51 34 35 44 29 35 33 51 46 49 49 42 31 35 29 37
42 40 30 30 43 47 31 50 42 20 37 37 52 42 31 54 47
37 37 32 38 30 36 35 35 30 39 42 42 39 39 46 34 38
39 46 34 50 49 50 50 39 49 45 50 49 53 53 46 50 50
34 50 42 51 46 26 49 51 43 42 50 47 60 60 60 60 45
63 44 35 60 60 42 51 60 44 54 58 44 50 60 50 50 28
60 40 40 63 44 28 60 44 44 44 52 47 47 44 60 57 43
42 57 63 63 35 47 43 47 60 34 63 60 28 40 43 47 63
43 43 63 43 47 35 57 63 23 35 47 24 41 40 46 47 29
53 53 35 24 42 35 46 57 29 52 60 44 47 46 44 42 30
43 34 60 29 46 41 63 63 53 28 44 17 46 46 22 41 52
22 47 46 19 46 23 39 44 42 63 35 52 63 24 52 15 46
46 63 63 41 23 41 63 28 30 25 63 63 63 34 47 29 52
44 52 32 44 63 12 35 63 29 63 43 28 22 35 63 63 43
21 63 26 34 63 63 35 17 12 10 15 63 63 43 41 31 27
29 24 31 41 22 27 63 27 35 43 21 35 35 28 31 22 32
24 21 24 51 46 29 44 21 50 54 31 42 53 36 35 25 57
54 35 49 34 44 59 29 44 34 34 34 57 36 35 39 39 28
57 39 31 42 34 42 52 19 53 53 27 42 57 39 57 54 14
57 54 22 50 57 29 38 33 54 34 44 35 44 22 53 27 21
21 31 34 24 32 24 57 30 36 35 32 21 38 30 30 57 32
41 32 28 35 17 57 15 51 32 22 59 40 20 27 54 22 54
17 59 38 28 28 29 36 25 34 35 21 30 30 42 17 35 30
45 46 21 49 12 46 35 49 33 52 22 42 19 36 52 28 35
24 21 26 27 13 34 28 28 25 28 46 52 29 15 14 15 24
21 28 28 33 26 26 12 17 21 46 28 26 19 15 20 50 23
50 20 21 27 46 19 26 13 21 34 20 26 21 29 17 28 17
24 49 28 16 29 17 17 20 30 16 31 18 32 12 16 28 26
21 29 21 17 13 12 34 34 16 40 37 46 26 21 19 28 50
50 28 18 13 20 32 20 12 16 11 22 11 8 9 20 43 18
32 19 37 17 35 11 21 16 21 18 25 18 28 36 20 14 21
9 10 31 38 17 14 19 21 11 18 13 8 24 11 7 10 12
13 24 20 19 11 16 10 17 10 12 9 12 9 9 9 10 11
16 9 6 10 12 14 14 20 18 20 13 9 17 11 17 16 16
13 19 11 6 9 10 11 11 16 18 10 12 17 28 14 14 14
14 6 16 17 7 10 12 8 8 19 11 17 16 13 10 19 28
9 30 20 11 12 13 14 10 10 16 17 9 10 22 18 23 16
16 10 10 22 16 13 14 13 7 7 6 5 6 6 10 9 10
8 18 30 19 13 17 23 15 16 13 20 23 9 12 13 10 7
10 15 11 17 30 17 18 13 12 12 9 14 14 12 12 11 16
7 11 14 14 11 13 13 11 12 13 16 9 13 14 7 9 12
28 10 8 14 19 14 9 13 11 26 17 26 21 19 18 22 13
10 13 14 10 8 16 13 28 22 18 19 17 23 21 20 31 31
29 32 17 23 14 19 8 9 19 23 14 13 20 14 14 12 12
10 7 10 11 11 8 9 11 10 11 16 8 10 19 19 14 10
22 6 12 17 11 19 13 32 22 13 13 10 16 23 15 6 12
8 14 17 19 13 20 21 14 7 9 9 10 13 12 7 11 14
14 11 17 11 13 7 8 11 23 13 16 10 12 7 12 11 16
18 11 11 18 22 20 15 18 8 12 11 16 11 19 19 8 16
17 17 16 10 7 12 10 16 7 12 7 7 12 7 10 10 7
10 6 7 9 7 9 8 9